Cell adhesion molecule 2 (CADM2) (NM_001167675) Human Untagged Clone
CAT#: SC328648
CADM2 (untagged)-Human cell adhesion molecule 2 (CADM2) transcript variant 2
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IGSF4D; Necl-3; NECL3; SynCAM 2; synCAM2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001167675, the custom clone sequence may differ by one or more nucleotides
ATGATTTGGAAACGCAGCGCCGTTCTCCGCTTCTACAGTGTCTGCGGGCTCCTGCTACAA GCGGCTGCTTCAAAGAATAAAGTTAAAGGCAGCCAAGGGCAGTTTCCACTAACACAGAAT GTAACCGTTGTTGAAGGTGGAACTGCAATTTTGACCTGCAGGGTTGATCAAAATGATAAC ACCTCCCTCCAGTGGTCAAATCCAGCTCAACAGACTCTGTACTTTGACGACAAGAAAGCT TTAAGGGACAATAGGATCGAGCTGGTTCGCGCTTCCTGGCATGAATTGAGTATTAGTGTC AGTGATGTGTCTCTCTCTGATGAAGGACAGTACACCTGTTCTTTATTTACAATGCCTGTC AAAACTTCCAAGGCATATCTCACCGTTCTGGGTGTTCCTGAAAAGCCTCAGATTAGTGGA TTCTCATCACCAGTTATGGAGGGTGACTTGATGCAGCTGACTTGCAAAACATCTGGTAGT AAACCTGCAGCTGATATAAGATGGTTCAAAAATGACAAAGAGATTAAAGATGTAAAATAT TTAAAAGAAGAGGATGCAAATCGCAAGACATTCACTGTCAGCAGCACACTGGACTTCCGA GTGGACCGGAGTGATGATGGAGTGGCGGTCATCTGCAGAGTAGATCACGAATCCCTCAAT GCCACCCCTCAGGTAGCCATGCAGGTGCTAGAAATACACTATACACCATCAGTTAAGATT ATACCATCGACTCCTTTTCCACAAGAAGGACAGCCTTTAATTTTGACTTGTGAATCCAAA GGAAAACCACTGCCAGAACCTGTTTTGTGGACAAAGGATGGCGGAGAATTACCAGATCCT GACCGAATGGTTGTGAGTGGTAGGGAGCTAAACATTCTTTTCCTGAACAAAACGGATAAT GGTACATATCGATGTGAAGCCACAAACACCATTGGCCAAAGCAGTGCGGAATATGTTCTC ATTGTGCATGATCCTAATGCTTTGGCTGGCCAGAATGGCCCTGACCATGCTCTCATAGGA GGAATAGTGGCTGTAGTTGTATTTGTCACGCTGTGTTCTATCTTTCTGCTTGGTCGATAT CTGGCAAGGCATAAAGGAACGTATTTAACAAATGAAGCTAAAGGAGCTGAAGATGCACCA GATGCTGATACAGCCATTATCAATGCTGAAGGCAGCCAAGTCAATGCTGAAGAGAAAAAA GAGTATTTCATTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001167675 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167675.1, NP_001161147.1 |
RefSeq Size | 9487 bp |
RefSeq ORF | 1215 bp |
Locus ID | 253559 |
UniProt ID | Q8N3J6 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) includes an alternate in-frame exon in the 5' coding region and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (2) differs in two regions, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230010 | CADM2 (Myc-DDK-tagged)-Human cell adhesion molecule 2 (CADM2), transcript variant 2 |
CNY 3,990.00 |
|
RC230010L3 | Lenti-ORF clone of CADM2 (Myc-DDK-tagged)-Human cell adhesion molecule 2 (CADM2), transcript variant 2 |
CNY 5,890.00 |
|
RC230010L4 | Lenti-ORF clone of CADM2 (mGFP-tagged)-Human cell adhesion molecule 2 (CADM2), transcript variant 2 |
CNY 5,890.00 |
|
RG230010 | CADM2 (tGFP-tagged) - Human cell adhesion molecule 2 (CADM2), transcript variant 2 |
CNY 4,370.00 |