United States
Germany
Japan
United Kingdom
China
MCG10 (PCBP4) (NM_001174100) Human Untagged Clone
CAT＃: SC328647
PCBP4 (untagged)-Human poly(rC) binding protein 4 (PCBP4) transcript variant 5
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CBP; LIP4; MCG10 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001174100, the custom clone sequence may differ by one or more nucleotides
ATGAGCGGCTCGGACGGGGGACTGGAGGAGGAGCCAGAGCTCAGCATCACCCTCACGCTG CGGATGCTGATGCACGGGAAGGAAGTGGGCAGCATCATCGGGAAGAAGGGCGAGACTGTA AAGCGAATCCGGGAGCAGAGCAGTGCCCGGATCACCATCTCCGAGGGCTCCTGCCCTGAA CGCATCACCACCATCACCGGGTCTACAGCAGCTGTCTTCCATGCAGTCTCCATGATTGCT TTCAAACTGGATGAGGACCTTTGTGCTGCTCCTGCAAATGGTGGAAATGTCTCCAGGCCT CCAGTGACCCTGCGCCTTGTCATCCCTGCCAGTCAGTGTGGCTCACTGATTGGGAAGGCT GGCACCAAGATCAAGGAGATCCGAGAGACTACGGGTGCCCAGGTACAGGTGGCAGGGGAC CTGCTCCCCAACTCCACAGAGCGAGCTGTTACGGTATCTGGGGTGCCTGATGCCATCATC CTGTGTGTGCGCCAGATCTGCGCTGTTATCCTGGAGTCCCCACCCAAAGGAGCCACTATC CCCTACCATCCGAGCCTCTCCCTAGGTACTGTTCTTCTCTCTGCCAACCAGGGCTTCTCT GTCCAGGGTCAGTATGGGGCTGTGACCCCAGCTGAGGTCACCAAGCTCCAGCAGCTCTCA AGCCATGCGGTCCCCTTTGCCACACCCAGCGTGGTGCCAGGACTGGATCCCGGCACACAG ACCAGCTCACAGGAGTTCTTGGTTCCCAACGATTTGATTGGCTGTGTGATCGGGCGCCAG GGCAGCAAGATCAGCGAGATCCGGCAGATGTCAGGGGCACATATCAAGATCGGGAACCAA GCAGAGGGCGCTGGGGAGCGGCATGTCACCATCACTGGCTCTCCGGTCTCCATCGCCCTG GCCCAGTACCTCATCACTGCCTGTCTAGAGACGGCCAAGTCTACCTCTGGGGGGACGCCC AGCTCGGCCCCCGCAGACCTGCCTGCCCCCTTCTCGCCACCCCTGACGGCCCTGCCCACA GCTCCCCCTGGCCTGCTGGGCACACCCTATGCCATCTCCCTCTCCAACTTCATCGGCCTC AAGCCCATGCCCTTCTTGGCTTTACCACCTGCTTCCCCAGGGCCGCCGCCGGGCTTGGCG GCCTACACTGCCAAGATGGCAGCAGCTAATGGGAGCAAGAAGGCTGAGCGGCAGAAATTC TCCCCCTACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001174100 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001174100.1, NP_001167571.1 |
| RefSeq Size | 2188 bp |
| RefSeq ORF | 1212 bp |
| Locus ID | 57060 |
| UniProt ID | P57723 |
| Gene Summary | This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) differs in the 5' UTR, and includes an additional in-frame exon in the central coding region, compared to variant 1. The encoded isoform (c) is longer than isoform a. Variants 3, 4 and 5 encode the same isoform. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC230009 | PCBP4 (Myc-DDK-tagged)-Human poly(rC) binding protein 4 (PCBP4), transcript variant 5 |
CNY 3,656.00 |
|
| RC230009L3 | Lenti-ORF clone of PCBP4 (Myc-DDK-tagged)-Human poly(rC) binding protein 4 (PCBP4), transcript variant 5 |
CNY 5,890.00 |
|
| RC230009L4 | Lenti-ORF clone of PCBP4 (mGFP-tagged)-Human poly(rC) binding protein 4 (PCBP4), transcript variant 5 |
CNY 5,890.00 |
|
| RG230009 | PCBP4 (tGFP-tagged) - Human poly(rC) binding protein 4 (PCBP4), transcript variant 5 |
CNY 4,370.00 |
