CD84 (NM_001184879) Human Untagged Clone
CAT#: SC328555
CD84 (untagged)-Human CD84 molecule (CD84) transcript variant 1
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hCD84; LY9B; mCD84; SLAMF5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001184879 edited
ATGGCTCAGCACCACCTATGGATCTTGCTCCTTTGCCTGCAAACCTGGCCGGAAGCAGCT GGAAAAGACTCAGAAATCTTCACAGTGAATGGGATTCTGGGAGAGTCAGTCACTTTCCCT GTAAATATCCAAGAACCACGGCAAGTTAAAATCATTGCTTGGACTTCTAAAACATCTGTT GCTTATGTAACACCAGGAGACTCAGAAACAGCACCCGTAGTTACTGTGACCCACAGAAAT TATTATGAACGGATACATGCCTTAGGTCCGAACTACAATCTGGTCATTAGCGATCTGAGG ATGGAAGACGCAGGAGACTACAAAGCAGACATAAATACACAGGCTGATCCCTACACCACC ACCAAGCGCTACAACCTGCAAATCTATCGTCGGCTTGGGAAACCAAAAATTACACAGAGT TTAATGGCATCTGTGAACAGCACCTGTAATGTCACACTGACATGCTCTGTAGAGAAAGAA GAAAAGAATGTGACATACAATTGGAGTCCCCTGGGAGAAGAGGGTAATGTCCTTCAAATC TTCCAGACTCCTGAGGACCAAGAGCTGACTTACACGTGTACAGCCCAGAACCCTGTCAGC AACAATTCTGACTCCATCTCTGCCCGGCAGCTCTGTGCAGACATCGCAATGGGCTTCCGT ACTCACCACACCGGGTTGCTGAGCGTGCTGGCTATGTTCTTTCTGCTTGTTCTCATTCTG TCTTCAGTGTTTTTGTTCCGTTTGTTCAAGAGAAGACAAGGTAGGATTTTCCCAGAAGGT TCCTGCTTGAACACCTTCACTAAGAACCCTTATGCTGCCTCAAAGAAAACCATATACACA TATATCATGGCTTCAAGGAACACCCAGCCAGCAGAGTCCAGAATCTATGATGAAATCCTG CAGTCCAAGGTGCTTCCCTCCAAGGAAGAGCCAGTGAACACAGTTTATTCCGAAGTGCAG TTTGCTGATAAGATGGGGAAAGCCAGCACACAGGACAGTAAACCTCCTGGGACTTCAAGC TATGAAATTGTGATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001184879 |
Insert Size | 3400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184879.1, NP_001171808.1 |
RefSeq Size | 8296 bp |
RefSeq ORF | 1038 bp |
Locus ID | 8832 |
UniProt ID | Q9UIB8 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript and it encodes the longest protein (isoform 1). This variant has also been called CD84a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229917 | CD84 (Myc-DDK-tagged)-Human CD84 molecule (CD84), transcript variant 1 |
CNY 5,488.00 |
|
RC229917L1 | Lenti ORF clone of Human CD84 molecule (CD84), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC229917L2 | Lenti ORF clone of Human CD84 molecule (CD84), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RC229917L3 | Lenti ORF clone of Human CD84 molecule (CD84), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229917L4 | Lenti ORF clone of Human CD84 molecule (CD84), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG229917 | CD84 (tGFP-tagged) - Human CD84 molecule (CD84), transcript variant 1 |
CNY 7,088.00 |