ZNF177 (ZNF559-ZNF177) (NM_001172650) Human Untagged Clone

CAT#: SC328526

ZNF559 (untagged)-Human zinc finger protein 177 (ZNF177) transcript variant 2



  "NM_001172650" in other vectors (2)

CNY 6,270.00


货期*
详询

规格
    • 10 ug

Product images

经常一起买 (4)
ZNF177 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172650, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCAGGGTGGCTGACAACCTGGTCACAGAACTCAGTAACCTTCCAGGAAGTGGCA
GTGGACTTTTCCCAGGAGGAGTGGGCATTGCTGGACCCTGCTCAAAAAAATCTATACAAA
GATGTGATGCTGGAGAACTTTAGGAACCTGGCCTCAGTAGGGTATCAGCTCTGCAGACAC
AGTCTGATCTCCAAGGTGGATCAAGAACAGCTGAAGACAGATGAAAGAGGAATTTTACAA
GGTGACTGTGCAGACTGGGAAACTCAACTTAAACCAAAAGATACAATTGCTATGCAGAAC
ATTCCTGGGGGAAAAACATCCAATGGCATAAACACGAACTGTGTCAGAACTCACTCTGGA
GAGATGCCCTATGAATGCAGTGACTGTGGGAAAGCCTTCATTTTTCAGTCTTCCCTTAAG
AAACACATGAGATCTCATACTGGAGAGAAGCCTTATGAGTGTGATCACTGTGGAAAATCC
TTTAGCCAGAGCTCTCATCTGAATGTGCACAAAAGAACTCACACTGGAGAGAAACCCTAT
GACTGTAAGGAATGTGGGAAGGCTTTCACTGTTCCTTCATCCCTTCAGAAACATGTGAGA
ACCCACACTGGAGAGAAACCCTATGAATGCAGTGACTGTGGAAAAGCCTTCATCGATCAG
TCATCCCTTAAGAAACACACACGCTCTCACACTGGAGAGAAGCCTTATGAGTGTAACCAG
TGTGGAAAGTCCTTCAGCACAGGCTCTTACCTTATTGTGCACAAGAGAACTCACACTGGT
GAGAAAACCTATGAGTGTAAAGAATGTGGGAAGGCCTTTAGGAATTCCTCTTGCCTGAGG
GTACACGTGAGAACTCACACTGGAGAGAAGCCTTATAAATGTATTCAGTGTGAAAAAGCC
TTTAGCACAAGCACTAACCTTATAATGCACAAGCGAATCCACAATGGCCAGAAACTCCAT
GAATGA
Restriction Sites Please inquire     
ACCN NM_001172650
Insert Size 2564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001172650.1, NP_001166121.1
RefSeq Size 2564 bp
RefSeq ORF 966 bp
Locus ID 100529215
UniProt ID Q13360
Gene Summary This locus represents naturally occurring read-through transcription between the neighboring zinc finger protein 559 (ZNF559) and zinc finger protein 177 (ZNF177) genes on chromosome 19. Alternative splicing results in multiple transcript variants, which encode the ZNF177 protein due to either leaky scanning by ribosomes, or absence of the ZNF559 start codon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) contains alternate exon structure in the 5' UTR, uses an alternate splice site that causes a frameshift in the 3' coding region, and lacks a segment of the 3' UTR, compared to variant 4. The resulting isoform (b) has a distinct and longer C-terminus, compared to isoform c. A non-read-through variant of the downstream ZNF177 gene, as represented by GeneID:7730, also encodes isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...