Zinc transporter 8 (SLC30A8) (NM_001172814) Human Untagged Clone
CAT#: SC328523
SLC30A8 (untagged)-Human solute carrier family 30 (zinc transporter) member 8 (SLC30A8) transcript variant 2
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZnT-8; ZNT8 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172814, the custom clone sequence may differ by one or more nucleotides
ATGTACCACTGCCACAGTGGCTCCAAGCCCACAGAAAAGGGGGCGAATGAGTACGCCTAT GCCAAGTGGAAACTCTGTTCTGCTTCAGCAATATGCTTCATTTTCATGATTGCAGAGGTC GTGGGTGGGCACATTGCTGGGAGTCTTGCTGTTGTCACAGATGCTGCCCACCTCTTAATT GACCTGACCAGTTTCCTGCTCAGTCTCTTCTCCCTGTGGTTGTCATCGAAGCCTCCCTCT AAGCGGCTGACATTTGGATGGCACCGAGCAGAGATCCTTGGTGCCCTGCTCTCCATCCTG TGCATCTGGGTGGTGACTGGCGTGCTAGTGTACCTGGCATGTGAGCGCCTGCTGTATCCT GATTACCAGATCCAGGCGACTGTGATGATCATCGTTTCCAGCTGCGCAGTGGCGGCCAAC ATTGTACTAACTGTGGTTTTGCACCAGAGATGCCTTGGCCACAATCACAAGGAAGTACAA GCCAATGCCAGCGTCAGAGCTGCTTTTGTGCATGCCCTTGGAGATCTATTTCAGAGTATC AGTGTGCTAATTAGTGCACTTATTATCTACTTTAAGCCAGAGTATAAAATAGCCGACCCA ATCTGCACATTCATCTTTTCCATCCTGGTCTTGGCCAGCACCATCACTATCTTAAAGGAC TTCTCCATCTTACTCATGGAAGGTGTGCCAAAGAGCCTGAATTACAGTGGTGTGAAAGAG CTTATTTTAGCAGTCGACGGGGTGCTGTCTGTGCACAGCCTGCACATCTGGTCTCTAACA ATGAATCAAGTAATTCTCTCAGCTCATGTTGCTACAGCAGCCAGCCGGGACAGCCAAGTG GTTCGGAGAGAAATTGCTAAAGCCCTTAGCAAAAGCTTTACGATGCACTCACTCACCATT CAGATGGAATCTCCAGTTGACCAGGACCCCGACTGCCTTTTCTGTGAAGACCCCTGTGAC TAG |
Restriction Sites | Please inquire |
ACCN | NM_001172814 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001172814.1, NP_001166285.1 |
RefSeq Size | 5403 bp |
RefSeq ORF | 963 bp |
Locus ID | 169026 |
UniProt ID | Q8IWU4 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a zinc efflux transporter involved in the accumulation of zinc in intracellular vesicles. This gene is expressed at a high level only in the pancreas, particularly in islets of Langerhans. The encoded protein colocalizes with insulin in the secretory pathway granules of the insulin-secreting INS-1 cells. Allelic variants of this gene exist that confer susceptibility to diabetes mellitus, noninsulin-dependent (NIDDM). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 4, and 5 all encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229885 | SLC30A8 (Myc-DDK-tagged)-Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 2 |
CNY 2,400.00 |
|
RC229885L3 | Lenti-ORF clone of SLC30A8 (Myc-DDK-tagged)-Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 2 |
CNY 5,890.00 |
|
RC229885L4 | Lenti-ORF clone of SLC30A8 (mGFP-tagged)-Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 2 |
CNY 5,890.00 |
|
RG229885 | SLC30A8 (tGFP-tagged) - Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 2 |
CNY 4,000.00 |
其它SLC30A8产品