United States
Germany
Japan
United Kingdom
China
Pepsinogen II (PGC) (NM_001166424) Human Untagged Clone
CAT＃: SC328510
PGC (untagged)-Human progastricsin (pepsinogen C) (PGC) transcript variant 2
CNY 6,270.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PEPC; PGII |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328510 representing NM_001166424.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGTGGATGGTGGTGGTCTTGGTCTGCCTCCAGCTCTTGGAGGCAGCAGTGGTCAAAGTGCCCCTG AAGAAATTTAAGTCTATCCGTGAGACCATGAAGGAGAAGGGCTTGCTGGGGGAGTTCCTGAGGACCCAC AAGTATGATCCTGCTTGGAAGTACCGCTTTGGTGACCTCAGCGTGACCTACGAGCCCATGGCCTACATG GATGCTGCCTACTTTGGTGAGATCAGCATCGGGACTCCACCCCAGAACTTCCTGGTCCTTTTTGACACC GGCTCCTCCAACTTGTGGGTGCCCTCTGTCTACTGCCAGAGCCAGGCCTGCACCAGTCACTCCCGCTTC AACCCCAGCGAGTCGTCCACCTACTCCACCAATGGGCAGACCTTCTCCCTGCAGTATGGCAGTGGCAGC CTCACCGGCTTCTTTGGCTATGACACCCTGACTGTCCAGAGCATCCAGGTCCCCAACCAGGAGTTCGGC TTGAGTGAGAATGAGCCTGGTACCAACTTCGTCTATGCGCAGTTTGATGGCATCATGGGCCTGGCCTAC CCTGCTCTGTCCGTGGATGAGGCCACCACAGCTATGCAGGGCATGGTGCAGGAGGGCGCCCTCACCAGC CCCGTCTTCAGCGTCTACCTCAGCAACCTGGTCCTGGAGTCTTCTGGTCTAGGTCCACTGCTGACCCCT AGCAGAGCAGCTCCACCCAGCTCCACACTCCAGCTACCAGAGAAGCCTCTGGAACAAACATGGAATATC CTTACCCCCTTCACCAAGACCCTACCTGTCTCCAATCTCAGCAGAAAAGTAACAAGCTGGGCCGGGGTG GGGATCCCGGTGACATGTCTACCAGAGGCAGGAAGCGGAGGGGAGAGGAGAGCAGAGTGTGGGCTGGGG GTCCCAACCACTAGGGGACCCCCCAGAAGTCAGCATCATTCGGGAGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001166424 |
| Insert Size | 948 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001166424.1 |
| RefSeq Size | 1152 bp |
| RefSeq ORF | 948 bp |
| Locus ID | 5225 |
| UniProt ID | P20142 |
| Protein Families | Protease, Secreted Protein |
| MW | 34.2 kDa |
| Gene Summary | This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) differs in the 3' UTR and 3' coding region, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
C53: A Novel Particulate Guanylyl Cyclase B Receptor Activator That Has Sustained Activity In Vivo With Anti-Fibrotic Actions in Human Cardiac and Renal Fibroblasts
,null,
Journal of molecular and cellular cardiology
,PubMed ID 30954448
[PGC]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229872 | PGC (Myc-DDK-tagged)-Human progastricsin (pepsinogen C) (PGC), transcript variant 2 |
CNY 2,400.00 |
|
| RC229872L3 | Lenti ORF clone of Human progastricsin (pepsinogen C) (PGC), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC229872L4 | Lenti ORF clone of Human progastricsin (pepsinogen C) (PGC), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG229872 | PGC (tGFP-tagged) - Human progastricsin (pepsinogen C) (PGC), transcript variant 2 |
CNY 4,370.00 |
其它Pepsinogen II产品
