RHBDD1 (NM_001167608) Human Untagged Clone

CAT#: SC328508

RHBDD1 (untagged)-Human rhomboid domain containing 1 (RHBDD1) transcript variant 2



  "NM_001167608" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RHBDD1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RHBDL4; RRP4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001167608, the custom clone sequence may differ by one or more nucleotides
ATGCAACGGAGATCAAGAGGGATAAATACTGGACTTATTCTACTCCTTTCTCAAATCTTC
CATGTTGGGATCAACAATATTCCACCTGTCACCCTAGCAACTTTGGCCCTCAACATCTGG
TTCTTCTTGAACCCTCAGAAGCCACTGTATAGCTCCTGCCTTAGTGTGGAGAAGTGTTAC
CAGCAAAAAGACTGGCAGCGTTTACTGCTCTCTCCCCTTCACCATGCTGATGATTGGCAT
TTGTATTTCAATATGGCATCCATGCTCTGGAAAGGAATAAATCTAGAAAGAAGACTGGGA
AGTAGATGGTTTGCCTATGTTATCACCGCATTTTCTGTACTTACTGGAGTGGTATACCTG
CTCTTGCAATTTGCTGTTGCCGAATTTATGGATGAACCTGACTTCAAAAGGAGCTGTGCT
GTAGGTTTCTCAGGAGTTTTGTTTGCTTTGAAAGTTCTTAACAACCATTATTGCCCTGGA
GGCTTTGTCAACATTTTGGGCTTTCCTGTACCGAACAGATTTGCTTGTTGGGTCGAACTT
GTGGCTATTCATTTATTCTCACCAGGGACTTCCTTCGCTGGGCATCTGGCTGGGATTCTT
GTTGGACTAATGTACACTCAAGGGCCTCTGAAGAAAATCATGGAAGCATGTGCAGGCGGT
TTTTCCTCCAGTGTTGGTTACCCAGGACGGCAATACTACTTTAATAGTTCAGGCAGCTCT
GGATATCAGGATTATTATCCGCATGGCAGGCCAGATCACTATGAAGAAGCACCCAGGAAC
TATGACACGTACACAGCAGGACTGAGTGAAGAAGAACAGCTCGAGAGAGCATTACAAGCC
AGCCTCTGGGACCGAGGAAATACCAGAAATAGCCCACCACCCTACGGGTTTCATCTCTCA
CCAGAAGAAATGAGGAGACAGCGGCTTCACAGATTCGATAGCCAGTGA
Restriction Sites Please inquire     
ACCN NM_001167608
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001167608.1, NP_001161080.1
RefSeq Size 5169 bp
RefSeq ORF 948 bp
Locus ID 84236
UniProt ID Q8TEB9
Protein Families Transmembrane
Gene Summary Intramembrane-cleaving serine protease that cleaves single transmembrane or multi-pass membrane proteins in the hydrophobic plane of the membrane, luminal loops and juxtamembrane regions. Involved in regulated intramembrane proteolysis and the subsequent release of functional polypeptides from their membrane anchors. Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded membrane proteins. Required for the degradation process of some specific misfolded endoplasmic reticulum (ER) luminal proteins. Participates in the transfer of misfolded proteins from the ER to the cytosol, where they are destroyed by the proteasome in a ubiquitin-dependent manner. Functions in BIK, MPZ, PKD1, PTCRA, RHO, STEAP3 and TRAC processing. Involved in the regulation of exosomal secretion; inhibits the TSAP6-mediated secretion pathway. Involved in the regulation of apoptosis; modulates BIK-mediated apoptotic activity. Also plays a role in the regulation of spermatogenesis; inhibits apoptotic activity in spermatogonia.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...