United States
Germany
Japan
United Kingdom
China
MAGEA12 (NM_001166386) Human Untagged Clone
CAT＃: SC328506
MAGEA12 (untagged)-Human melanoma antigen family A 12 (MAGEA12) transcript variant 1
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT1.12; MAGE12 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001166386, the custom clone sequence may differ by one or more nucleotides
ATGCCACTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGAGGCCCAAGGA GAGGCCCTGGGCTTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGGAGACTGCCTCC TCCTCCTCTACTCTAGTGGAAGTCACCCTGCGGGAGGTGCCTGCTGCCGAGTCACCAAGT CCTCCCCACAGTCCTCAGGGAGCCTCCACCCTCCCCACTACCATCAACTATACTCTCTGG AGTCAATCCGATGAGGGCTCCAGCAACGAAGAACAGGAAGGGCCAAGCACCTTTCCTGAC CTGGAGACGAGCTTCCAAGTAGCACTCAGTAGGAAGATGGCTGAGTTGGTTCATTTTCTG CTCCTCAAGTATCGAGCCAGGGAGCCATTCACAAAGGCAGAAATGCTGGGGAGTGTCATC AGAAATTTCCAGGACTTCTTTCCTGTGATCTTCAGCAAAGCCTCCGAGTACTTGCAGCTG GTCTTTGGCATCGAGGTGGTGGAAGTGGTCCGCATCGGCCACTTGTACATCCTTGTCACC TGCCTGGGCCTCTCCTACGATGGCCTGCTGGGCGACAATCAGATCGTGCCCAAGACAGGC CTCCTGATAATCGTCCTGGCCATAATCGCAAAAGAGGGCGACTGTGCCCCTGAGGAGAAA ATCTGGGAGGAGCTGAGTGTGTTGGAGGCATCTGATGGGAGGGAGGACAGTGTCTTTGCG CATCCCAGGAAGCTGCTCACCCAAGATTTGGTGCAGGAAAACTACCTGGAGTACCGGCAG GTCCCCGGCAGTGATCCTGCATGCTACGAGTTCCTGTGGGGTCCAAGGGCCCTCGTTGAA ACCAGCTATGTGAAAGTCCTGCACCATTTGCTAAAGATCAGTGGAGGACCTCACATTTCC TACCCACCCCTGCATGAATGGGCTTTTAGAGAGGGGGAAGAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001166386 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001166386.1, NP_001159858.1 |
| RefSeq Size | 1876 bp |
| RefSeq ORF | 945 bp |
| Locus ID | 4111 |
| UniProt ID | P43365 |
| Gene Summary | This gene is closely related to several other genes clustered on chromosome X. These genes may be overexpressed in tumors. Multiple alternatively spliced variants encoding the same protein have been identified. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229868 | MAGEA12 (Myc-DDK-tagged)-Human melanoma antigen family A, 12 (MAGEA12), transcript variant 1 |
CNY 3,840.00 |
|
| RC229868L3 | Lenti-ORF clone of MAGEA12 (Myc-DDK-tagged)-Human melanoma antigen family A, 12 (MAGEA12), transcript variant 1 |
CNY 5,890.00 |
|
| RC229868L4 | Lenti-ORF clone of MAGEA12 (mGFP-tagged)-Human melanoma antigen family A, 12 (MAGEA12), transcript variant 1 |
CNY 6,240.00 |
|
| RG229868 | MAGEA12 (tGFP-tagged) - Human melanoma antigen family A, 12 (MAGEA12), transcript variant 1 |
CNY 5,440.00 |
其它MAGEA12产品
