Mitocondrial Translational Initiation Factor 3 (MTIF3) (NM_001166261) Human Untagged Clone

CAT#: SC328450

MTIF3 (untagged)-Human mitochondrial translational initiation factor 3 (MTIF3) nuclear gene encoding mitochondrial protein transcript variant 4



  "NM_001166261" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MTIF3 mouse monoclonal antibody, clone OTI1E8 (formerly 1E8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IF3mt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328450 representing NM_001166261.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCTCTTTTTCTAAAGAGGTTAACACTACAAACTGTAAAGTCTGAAAATAGTTGCATTAGATGT
TTTGGTAAACACATCCTGCAAAAGACAGCACCAGCACAGTTGTCCCCTATTGCTTCTGCCCCAAGACTC
TCCTTCCTAATTCATGCAAAAGCCTTTAGTACCGCTGAAGACACCCAGAATGAAGGAAAAAAGACAAAA
AAGAATAAAACAGCTTTTAGTAACGTTGGAAGAAAAATTAGTCAGCGAGTTATTCACTTATTTGATGAG
AAGGGCAATGATTTGGGAAACATGCACCGAGCAAATGTGATTAGACTTATGGATGAGCGAGACCTGCGA
CTGGTTCAAAGGAACACCAGCACAGAACCTGCAGAGTATCAGCTCATGACAGGATTGCAGATCCTCCAG
GAGCGGCAGAGGCTGAGGGAGATGGAGAAGGCGAACCCCAAAACTGGACCAACCCTGAGAAAGGAACTG
ATTTTGTCTTCAAATATTGGACAACATGATTTGGACACAAAGACTAAACAGATTCAGCAGTGGATTAAG
AAAAAACACCTAGTCCAGATTACCATAAAGAAAGGAAAAAATGTAGACGTGTCAGAAAATGAAATGGAG
GAGATATTTCATCAAATACTCCAGACTATGCCTGGAATAGCTACATTCTCATCTAGGCCACAAGCTGTT
CAAGGAGGAAAAGCTTTAATGTGTGTTCTTCGTGCTTTCAGCAAAAATGAGGAGAAGGCATATAAAGAA
ACTCAAGAGACCCAGGAAAGAGACACTTTGAACAAAGACCATGGAAATGATAAGGAATCAAATGTTCTG
CATCAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166261
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166261.1
RefSeq Size 999 bp
RefSeq ORF 837 bp
Locus ID 219402
UniProt ID Q9H2K0
MW 31.7 kDa
Gene Summary This gene encodes a translation initiation factor that is involved in mitochondrial protein synthesis. Polymorphism in this gene is associated with the onset of Parkinson's disease. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Mitocondrial Translational Initiation Factor 3产品

Customer Reviews 
Loading...