CFHR3 (NM_001166624) Human Untagged Clone
CAT#: SC328438
CFHR3 (untagged)-Human complement factor H-related 3 (CFHR3) transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CFHL3; DOWN16; FHR-3; FHR3; HLF4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328438 representing NM_001166624.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTGTTACTAATCAATGTCATTCTGACCTTGTGGGTTTCCTGTGCTAATGGACAAGTGAAACCTTGT GATTTTCCAGACATTAAACATGGAGGTCTATTTCATGAGAATATGCGTAGACCATACTTTCCAGTAGCT GTAGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTCCTTCAGGAAGTTACTGGGATTAC ATTCATTGCACACAAAATGGGTGGTCACCAGCAGTACCATGTCTCAGAAAATGTTATTTTCCTTATTTG GAAAATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAGGGTAACTCTACAGAAGTTGCCTGCCAT CCTGGCTACGGTCTTCCAAAAGCGCAGACCACAGTTACATGTACGGAGAAAGGCTGGTCTCCTACTCCC AGATGCATCCGTGTCAATTCTTCAGAAAAGTGTGGGCCTCCTCCACCTATTAGCAATGGTGATACCACC TCCTTTCTACTAAAAGTGTATGTGCCACAGTCAAGAGTCGAGTACCAATGCCAGCCCTACTATGAACTT CAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGGTCGGAACCACCAAGATGCATACATCCATGT ATAATAACTGAAGAAAACATGAATAAAAATAACATAAAGTTAAAAGGAAGAAGTGACAGAAAATATTAT GCAAAAACAGGGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCAAATACATCAATTCTATCA TTTCAAGCAGTGTGTCGGGAAGGGATAGTGGAATACCCCAGATGCGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166624 |
Insert Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001166624.1 |
RefSeq Size | 1484 bp |
RefSeq ORF | 810 bp |
Locus ID | 10878 |
UniProt ID | Q02985 |
Protein Families | Secreted Protein |
MW | 30.7 kDa |
Gene Summary | The protein encoded by this gene is a secreted protein, which belongs to the complement factor H-related protein family. It binds to heparin, and may be involved in complement regulation. Mutations in this gene are associated with decreased risk of age-related macular degeneration, and with an increased risk of atypical hemolytic-uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) lacking an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229800 | CFHR3 (Myc-DDK-tagged)-Human complement factor H-related 3 (CFHR3), transcript variant 2 |
CNY 2,400.00 |
|
RC229800L1 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC229800L2 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC229800L3 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229800L4 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG229800 | CFHR3 (tGFP-tagged) - Human complement factor H-related 3 (CFHR3), transcript variant 2 |
CNY 4,370.00 |