MNAT1 (NM_001177963) Human Untagged Clone
CAT#: SC328434
MNAT1 (untagged)-Human menage a trois homolog 1 cyclin H assembly factor (Xenopus laevis) (MNAT1) transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAP35; MAT1; RNF66; TFB3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328434 representing NM_001177963.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGATCAGGGTTGCCCTCGGTGTAAGACCACCAAATATCGGAACCCCTCCTTGAAGCTGATGGTG AATGTGTGCGGACACACTCTCTGTGAAAGTTGTGTAGATTTACTGTTTGTGAGAGGAGCTGGAAACTGC CCTGAGTGTGGTACTCCACTCAGAAAGAGCAACTTCAGGGTACAACTCTTTGAAGATCCCACTGTTGAC AAGGAGGTTGAGATCAGGAAAAAAGTGCTAAAGATATACAATAAAAGGGAAGAAGATTTTCCTAGTCTA AGAGAATACAATGATTTCTTGGAAGAAGTGGAAGAAATTGTTTTCAACTTGACCAACAATGTGGATTTG GACAACACCAAAAAGAAAATGGAGATATACCAAAAGGAAAACAAAGATGTTATTCAGAAAAATAAATTA AAGCTGACTCGAGAACAGGAAGAACTGGAAGAAGCTTTAGAAGTGGAACGACAGGAAAATGAACAAAGA AGATTATTTATACAAAAAGAAGAACAACTGCAGCAGATTCTAAAAAGGAAGAATAAGCAGGCTTTTTTA GATGAGCTGGGTCAACATATTTCACTGGCACCTATTCACAAGCTTGAAGAAGCTCTGTATGAATACCAG CCACTGCAGATAGAGACATATGGACCACATGTTCCTGAGCTTGAGATGCTAGGAAGACTTGGGTATTTA AACCATGTCAGAGCTGCCTCACCACAGGACCTTGCTGGAGGCTATACTTCTTCTCTTGCTTGTCACAGA GCACTACAGGATGCATTCAGTGGGCTTTTCTGGCAGCCCAGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177963 |
Insert Size | 804 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001177963.1 |
RefSeq Size | 1271 bp |
RefSeq ORF | 804 bp |
Locus ID | 4331 |
UniProt ID | P51948 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Nucleotide excision repair |
MW | 31.1 kDa |
Gene Summary | The protein encoded by this gene, along with cyclin H and CDK7, forms the CDK-activating kinase (CAK) enzymatic complex. This complex activates several cyclin-associated kinases and can also associate with TFIIH to activate transcription by RNA polymerase II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) lacks an exon in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229796 | MNAT1 (Myc-DDK-tagged)-Human menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) (MNAT1), transcript variant 2 |
CNY 2,400.00 |
|
RC229796L3 | Lenti ORF clone of Human menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) (MNAT1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229796L4 | Lenti ORF clone of Human menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) (MNAT1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG229796 | MNAT1 (tGFP-tagged) - Human menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) (MNAT1), transcript variant 2 |
CNY 4,370.00 |