SUN1 (NM_001171946) Human Untagged Clone
CAT#: SC328415
SUN1 (untagged)-Human Sad1 and UNC84 domain containing 1 (SUN1) transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UNC84A |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171946, the custom clone sequence may differ by one or more nucleotides
ATGGATTTTTCTCGGCTTCACATGTACAGTCCTCCCCAGTGTGTGCCGGAGAACACGGGC TACACGTATGCGCTCAGTTCCAGCTATTCTTCAGATGCTCTGGATTTTGAGACGGAGCAC AAATTGGACCCTGTATTTGATTCTCCACGGATGTCCCGCCGTAGTTTGCGCCTGGCCACG ACAGCATGCACCCTGGGGGATGGTGAGGCTGTGGGTGCCGACAGCGGCACCAGCAGCGCT GTCTCCCTGAAGAACCGAGCGGCCAGAACAACAAAACAGCGCAGAAGCACAAACAAATCA GCTTTTAGTATCAACCACGTGTCAAGGCAGGTCACGTCCTCTGGCGTCAGCCACGGCGGC ACTGTCAGCCTGCAGGATGCTGTGACTCGACGGCCTCCTGTATTGGACGAGTCTTGGATT CGTGAACAGACCACAGTGGACCACTTCTGGGGTCTTGATGATGATGGTGATCTTAAAGGT GGAAATAAAGCTGCCATTCAGGGAAACGGGGATGTGGGAGCCGCCGCCGCCACCGCGCAC AACGGCTTCTCCTGCAGCAACTGCAGCATGCTGTCCGAGCGCAAGGACGTGCTCACGGCG CACCCCGCGGCCCCCGGGCCCGTGTCGAGAGTTTATTCTAGGGACAGGAATCAAAAATGT AAGTCTCAGTCCTTTAAAACTCAGAAAAAGGTGTGTTTTCCAAATTTAATATTTCCTTTC TGTAAGTCTCAGTGTCTGCACTATTTGTCTTGGAGACTTAAAATTATCCCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001171946 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001171946.1, NP_001165417.1 |
RefSeq Size | 1077 bp |
RefSeq ORF | 774 bp |
Locus ID | 23353 |
UniProt ID | O94901 |
Protein Families | Transmembrane |
Gene Summary | This gene is a member of the unc-84 homolog family and encodes a nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2019] Transcript Variant: This variant (5) differs in the 5' UTR, 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (e) has a distinct C-terminus and is shorter than isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229777 | SUN1 (Myc-DDK-tagged)-Human Sad1 and UNC84 domain containing 1 (SUN1), transcript variant 5 |
CNY 3,990.00 |
|
RC229777L3 | Lenti-ORF clone of SUN1 (Myc-DDK-tagged)-Human Sad1 and UNC84 domain containing 1 (SUN1), transcript variant 5 |
CNY 5,890.00 |
|
RC229777L4 | Lenti-ORF clone of SUN1 (mGFP-tagged)-Human Sad1 and UNC84 domain containing 1 (SUN1), transcript variant 5 |
CNY 5,890.00 |
|
RG229777 | SUN1 (tGFP-tagged) - Human Sad1 and UNC84 domain containing 1 (SUN1), transcript variant 5 |
CNY 4,370.00 |