United States
Germany
Japan
United Kingdom
China
Interleukin 34 (IL34) (NM_001172772) Human Untagged Clone
CAT＃: SC328389
IL34 (untagged)-Human interleukin 34 (IL34) transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C16orf77; IL-34 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001172772, the custom clone sequence may differ by one or more nucleotides
ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGG AATGAGCCTTTGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTT CTGCGGGACAAGCTGCAGTACAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATC AACTACAAGATCAGTGTGCCTTACGAGGGGGTGTTCAGAATCGCCAACGTCACCAGGCTG CAGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGGTCTTGGTGAGCCTCAGT GCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTACCTGCAG GAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCC AAGGTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGG CCCAAAGCCCTGCTGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGT AAACAAAGCTCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGC CCAGAGCCCTCATTGCAGTATGCGGCCACCCAGCTGTACCCTCCGCCCCCGTGGTCCCCC AGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGGCACAGGGCGAGGGCCTC TTGCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001172772 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001172772.1, NP_001166243.1 |
| RefSeq Size | 1779 bp |
| RefSeq ORF | 729 bp |
| Locus ID | 146433 |
| UniProt ID | Q6ZMJ4 |
| Gene Summary | Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]).[supplied by OMIM, May 2008] Transcript Variant: This variant (3) represents use of an alternate promoter and 5' UTR, compared to variant 1. Both variants 1 and 3 encode the same isoform (1), which is longer than isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229751 | IL34 (Myc-DDK-tagged)-Human interleukin 34 (IL34), transcript variant 3 |
CNY 3,990.00 |
|
| RC229751L3 | Lenti-ORF clone of IL34 (Myc-DDK-tagged)-Human interleukin 34 (IL34), transcript variant 3 |
CNY 5,890.00 |
|
| RC229751L4 | Lenti-ORF clone of IL34 (mGFP-tagged)-Human interleukin 34 (IL34), transcript variant 3 |
CNY 5,890.00 |
|
| RG229751 | IL34 (tGFP-tagged) - Human interleukin 34 (IL34), transcript variant 3 |
CNY 4,370.00 |
其它Interleukin 34产品
