United States
Germany
Japan
United Kingdom
China
CINP (NM_001177611) Human Untagged Clone
CAT＃: SC328359
CINP (untagged)-Human cyclin-dependent kinase 2 interacting protein (CINP) transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGC849 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001177611, the custom clone sequence may differ by one or more nucleotides
ATGAACGGGACGATATACGCAAATGAGTGTCAGCAGATCCGACATCCAAATTCAAAGACT CTTGGAACTGTAACGCCCAGAAAACCTGTCTTATCTGTCAGTGCAAGAAAAATTAAGGAC AATGCGGCTGATTGGCACAATTTAATCCTGAAGTGGGAAACCCTCAATGATGCAGGTTTT ACCACTGCAAATAATATTGCCAACTTGAAAATCAGTTTATTGAATAAAGACAAGATAGAA CTAGACAGCAGCAGCCCAGCCTCGAAGGAAAATGAAGAAAAGGTGTGTCTGGAATATAAC GAGGAACTGGAGAAGCTGTGTGAGGAACTGCAGGCCACCTTGGATGGGTTGACCAAAATA CAGGTGAAAATGGAAAAGCTGTCTTCAACTACCAAGGGAATTTGTGAACTAGAAAACTAC CATTATGGGGAGGAGAGTAAACGACCCCCTCTGTTCCACACGTGGCCTACAACCCATTTC TATGAGGTTTCGCATAAGCTCTTGGAGATGTACAGGAAGGAGCTGCTCCTGAAGCGCACG GTGGCCAAGGAGCTTGCCCACACCGGGGATCCCGACCTCACCCTGAGCTACCTGTCCATG TGGCTGCACCAGCCCTATGTGGAGAGCGACAGCAGGCTGCATCTGGAGAGCATGCTGCTG GAGACAGGCCACCGAGCTCTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001177611 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001177611.1, NP_001171082.1 |
| RefSeq Size | 1065 bp |
| RefSeq ORF | 684 bp |
| Locus ID | 51550 |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene is reported to be a component of the DNA replication complex as well as a genome-maintenance protein. It may interact with proteins important for replication initiation and has been shown to bind chromatin at the G1 phase of the cell cycle and dissociate from chromatin with replication initiation. It may also serve to regulate checkpoint signaling as part of the DNA damage response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229721 | CINP (Myc-DDK-tagged)-Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
CNY 3,990.00 |
|
| RC229721L3 | Lenti-ORF clone of CINP (Myc-DDK-tagged)-Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
CNY 5,890.00 |
|
| RC229721L4 | Lenti-ORF clone of CINP (mGFP-tagged)-Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
CNY 5,890.00 |
|
| RG229721 | CINP (tGFP-tagged) - Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
CNY 4,370.00 |
