SENP8 (NM_001172111) Human Untagged Clone
CAT#: SC328334
SENP8 (untagged)-Human SUMO/sentrin specific peptidase family member 8 (SENP8) transcript variant 5
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEN1; NEDP1; PRSC2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172111, the custom clone sequence may differ by one or more nucleotides
ATGGACCCCGTAGTCTTGAGTTACATGGACAGTCTACTGCGGCAATCAGATGTCTCACTA TTGGATCCGCCAAGCTGGCTCAATGACCATATTATTGGGTTTGCGTTTGAGTACTTTGCC AACAGTCAGTTTCATGACTGCTCTGATCACGTCAGTTTCATCAGCCCTGAAGTCACCCAG TTCATCAAGTGCACTAGCAACCCAGCAGAGATTGCCATGTTCCTTGAACCACTGGACCTC CCCAACAAGAGAGTTGTATTTTTAGCCATCAATGATAACTCCAACCAGGCAGCTGGAGGA ACCCACTGGAGTTTATTGGTCTACCTCCAAGATAAAAATAGCTTTTTTCATTATGATTCC CATAGCAGGAGCAACTCAGTTCACGCAAAGCAGGTAGCAGAGAAACTGGAGGCTTTCTTA GGCAGAAAAGGAGACAAACTGGCCTTTGTGGAAGAGAAAGCCCCTGCCCAACAAAACAGC TATGACTGTGGGATGTACGTGATATGTAACACTGAGGCCTTGTGTCAGAACTTCTTTAGG CAACAGACAGAATCACTGCTGCAGCTACTCACCCCTGCATACATCACAAAGAAGAGGGGA GAATGGAAAGATCTCATTACCACACTTGCTAAAAAGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001172111 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001172111.1, NP_001165582.1 |
RefSeq Size | 1693 bp |
RefSeq ORF | 639 bp |
Locus ID | 123228 |
UniProt ID | Q96LD8 |
Protein Families | Druggable Genome, Protease |
Gene Summary | This gene encodes a cysteine protease that is a member of the sentrin-specific protease family. The encoded protein is involved in processing and deconjugation of the ubiquitin-like protein termed, neural precursor cell expressed developmentally downregulated 8. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same protein. An in-frame AUG is located 44 codons upstream of the annotated translation start site but is not being annotated as a start site since it is not conserved and is in a weak Kozak sequence context. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229696 | SENP8 (Myc-DDK-tagged)-Human SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5 |
CNY 2,400.00 |
|
RC229696L3 | Lenti-ORF clone of SENP8 (Myc-DDK-tagged)-Human SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5 |
CNY 5,890.00 |
|
RC229696L4 | Lenti-ORF clone of SENP8 (mGFP-tagged)-Human SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5 |
CNY 5,890.00 |
|
RG229696 | SENP8 (tGFP-tagged) - Human SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5 |
CNY 4,370.00 |