Oct4 (POU5F1) (NM_001173531) Human Untagged Clone
CAT#: SC328296
POU5F1/OCT4 (untagged)-Human POU class 5 homeobox 1 (POU5F1/OCT4) transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Oct-3; Oct-4; OCT3; OCT4; OTF-3; OTF3; OTF4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001173531, the custom clone sequence may differ by one or more nucleotides
CTGGGGGTTCTATTTGGGAAGGTATTCAGCCAAACGACCATCTGCCGCTTTGAGGCTCTG CAGCTTAGCTTCAAGAACATGTGTAAGCTGCGGCCCTTGCTGCAGAAGTGGGTGGAGGAA GCTGACAACAATGAAAATCTTCAGGAGATATGCAAAGCAGAAACCCTCGTGCAGGCCCGA AAGAGAAAGCGAACCAGTATCGAGAACCGAGTGAGAGGCAACCTGGAGAATTTGTTCCTG CAGTGCCCGAAACCCACACTGCAGCAGATCAGCCACATCGCCCAGCAGCTTGGGCTCGAG AAGGATGTGGTCCGAGTGTGGTTCTGTAACCGGCGCCAGAAGGGCAAGCGATCAAGCAGC GACTATGCACAACGAGAGGATTTTGAGGCTGCTGGGTCTCCTTTCTCAGGGGGACCAGTG TCCTTTCCTCTGGCCCCAGGGCCCCATTTTGGTACCCCAGGCTATGGGAGCCCTCACTTC ACTGCACTGTACTCCTCGGTCCCTTTCCCTGAGGGGGAAGCCTTTCCCCCTGTCTCCGTC ACCACTCTGGGCTCTCCCATGCATTCAAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001173531 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173531.1, NP_001167002.1 |
RefSeq Size | 1257 bp |
RefSeq ORF | 573 bp |
Locus ID | 5460 |
Protein Families | Adult stem cells, Cancer stem cells, Embryonic stem cells, Induced pluripotent stem cells, Stem cell - Pluripotency, Transcription Factors |
Gene Summary | This gene encodes a transcription factor containing a POU homeodomain that plays a key role in embryonic development and stem cell pluripotency. Aberrant expression of this gene in adult tissues is associated with tumorigenesis. This gene can participate in a translocation with the Ewing's sarcoma gene on chromosome 21, which also leads to tumor formation. Alternative splicing, as well as usage of alternative AUG and non-AUG translation initiation codons, results in multiple isoforms. One of the AUG start codons is polymorphic in human populations. Related pseudogenes have been identified on chromosomes 1, 3, 8, 10, and 12. [provided by RefSeq, Oct 2013] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame non-AUG (CUG) start codon, compared to variant 1. The resulting isoform (2, also known as OCT4B-190) is shorter at the N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2). This variant may encode an additional isoform through the use of an alternative downstream AUG start codon. Use of alternate start codons and the non-AUG start codon is described in PMID:19489092. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229658 | POU5F1/OCT4 (Myc-DDK-tagged)-Human POU class 5 homeobox 1 (POU5F1/OCT4), transcript variant 3 |
CNY 3,990.00 |
|
RC229658L3 | Lenti-ORF clone of POU5F1/OCT4 (Myc-DDK-tagged)-Human POU class 5 homeobox 1 (POU5F1/OCT4), transcript variant 3 |
CNY 5,890.00 |
|
RC229658L4 | Lenti-ORF clone of POU5F1/OCT4 (mGFP-tagged)-Human POU class 5 homeobox 1 (POU5F1/OCT4), transcript variant 3 |
CNY 5,890.00 |
|
RG229658 | POU5F1 (tGFP-tagged) - Human POU class 5 homeobox 1 (POU5F1), transcript variant 3 |
CNY 4,370.00 |