LOX (NM_001178102) Human Untagged Clone
CAT#: SC328289
LOX (untagged)-Human lysyl oxidase (LOX) transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AAT10 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001178102 edited
ATGTCCATGTACAACCTGAGATGCGCGGCGGAGGAAAACTGTCTGGCCAGTACAGCATAC AGGGCAGATGTCAGAGATTATGATCACAGGGTGCTGCTCAGATTTCCCCAAAGAGTGAAA AACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGT TGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAAC ACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGT GACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGC TGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAA CCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGAC TATACCAACAATGTTGTGCGCTGTGACATTCGCTACACAGGACATCATGCGTATGCCTCA GGCTGCACAATTTCACCGTAT |
Restriction Sites | Please inquire |
ACCN | NM_001178102 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001178102.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001178102.1, NP_001171573.1 |
RefSeq Size | 4393 bp |
RefSeq ORF | 564 bp |
Locus ID | 4015 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a member of the lysyl oxidase family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a regulatory propeptide and the mature enzyme. The copper-dependent amine oxidase activity of this enzyme functions in the crosslinking of collagens and elastin, while the propeptide may play a role in tumor suppression. In addition, defects in this gene have been linked with predisposition to thoracic aortic aneurysms and dissections. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) is shorter at the N-terminus and lacks a predicted signal peptide compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229651 | LOX (Myc-DDK-tagged)-Human lysyl oxidase (LOX), transcript variant 2 |
CNY 3,990.00 |
|
RC229651L3 | Lenti-ORF clone of LOX (Myc-DDK-tagged)-Human lysyl oxidase (LOX), transcript variant 2 |
CNY 5,890.00 |
|
RC229651L4 | Lenti-ORF clone of LOX (mGFP-tagged)-Human lysyl oxidase (LOX), transcript variant 2 |
CNY 5,890.00 |
|
RG229651 | LOX (tGFP-tagged) - Human lysyl oxidase (LOX), transcript variant 2 |
CNY 4,240.00 |