RABL4 (IFT27) (NM_001177701) Human Untagged Clone

CAT#: SC328286

IFT27 (untagged)-Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27) transcript variant 1



  "NM_001177701" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IFT27 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BBS19; FAP156; RABL4; RAYL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001177701, the custom clone sequence may differ by one or more nucleotides
ATGGTGAAGCTGGCAGCCAAATGCATCCTGGCAGGAGACCCAGCAGTGGGCAAGACCGCC
CTGGCACAGATCTTCCGCAGTGATGGAGCCCATTTCCAGAAAAGCTACACCCTGACAACA
GGAATGGATTTGGTGGTGAAGACAGTGCCAGTTCCTGACACGGGAGACAGTGTGGAACTC
TTCATTTTTGACTCTGCTGGCAAGGAGCTGTTTTCGGAAATGCTGGATAAATTGTGGGAG
AGTCCCAATGTCTTATGTCTCGTCTATGATGTGACCAATGAAGAATCCTTCAACAACTGC
AGCAAGTGGCTGGAGAAGGCTCGGTCACAGGCTCCAGGCATCTCTCTCCCAGGTGTTTTA
GTTGGGAACAAGACAGACCTGGCCGGCAGACGAGCAGTGGACTCAGCTGAGGCCCGGGCA
TGGGCGCTGGGCCAGGGCCTGGAATGTTTTGAAACATCCGTGAAAGAGATGGAAAACTTC
GAAGCCCCTTTCCACTGCCTTGCCAAGCAGTTCCACCAGCTGTACCGGGAGAAGGTGGAG
GTTTTCCGGGCCCTGGCATGA
Restriction Sites Please inquire     
ACCN NM_001177701
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177701.1, NP_001171172.1
RefSeq Size 1104 bp
RefSeq ORF 1104 bp
Locus ID 11020
UniProt ID Q9BW83
Protein Families Druggable Genome
Gene Summary This gene encodes a GTP-binding protein that is a core component of the intraflagellar transport complex B. Characterization of the similar Chlamydomonas protein indicates a function in cell cycle control. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 5 encode isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...