HDHD1A (PUDP) (NM_001178136) Human Untagged Clone
CAT#: SC328283
HDHD1 (untagged)-Human haloacid dehalogenase-like hydrolase domain containing 1A (HDHD1A) transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DXF68S1E; FAM16AX; GS1; HDHD1; HDHD1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328283 representing NM_001178136.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGCCCCCGCAGCCCGTCACCCACCTCATCTTTGACATGGACGGACTTCTTCTGGATACTGAA CGGCTGTATTCAGTGGTGTTTCAAGAAATATGTAATCGCTATGACAAGAAATACAGCTGGGATGTAAAG TCCCTGGTTATGGGGGCGGAGAAACTCATCATCCACCTGCGGAAACATGGCATCCCCTTTGCACTGGCC ACCAGCTCGGGGTCCGCGTCGTTCGATATGAAGACAAGCCGCCACAAGGAGTTCTTCAGCTTGTTTTCC CACATTGTGCTGGGAGATGACCCCGAAGTGCAGCATGGCAAGCCAGACCCGGACATCTTCCTAGCTTGT GCCAAGAGGTTCTCTCCCCCTCCTGCTATGGAGAAGTGCCTTGTCTTTGAAGATGCTCCCAATGGGGTG GAGGCGGCCCTGGCAGCTGGGATGCAGGTGGTCATGGTTCCTGACGGAAACTTGAGCCGAGATCTGACA ACAAAGGCCACCCTGGTGCTGAATTCCCTGCAGGACTTCCAGCCCGAGCTGTTTGGTTTGCCCTCCTAT GAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178136 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001178136.1 |
RefSeq Size | 2026 bp |
RefSeq ORF | 558 bp |
Locus ID | 8226 |
UniProt ID | Q08623 |
MW | 20.5 kDa |
Gene Summary | This gene encodes a member of the haloacid dehalogenase-like (HAD) hydrolase superfamily. The encoded protein has no known biological function. This gene has a pseudogene on chromosome 1. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (4) lacks an in-frame segment in the CDS compared to variant 1. The resulting isoform (d) lacks an internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229645 | HDHD1 (Myc-DDK-tagged)-Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 4 |
CNY 2,400.00 |
|
RC229645L3 | Lenti ORF clone of Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229645L4 | Lenti ORF clone of Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG229645 | HDHD1 (tGFP-tagged) - Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 4 |
CNY 4,370.00 |