C19orf50 (KXD1) (NM_001171948) Human Untagged Clone
CAT#: SC328275
KXD1 (untagged)-Human chromosome 19 open reading frame 50 (C19orf50) transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BORCS4; C10orf50; C19orf50; KXDL; MST096; MSTP096 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328275 representing NM_001171948.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACCTCCCGGACTCGGCCTCGAGGGTCTTCTGCGGCCGCATCCTGAGCATGGTGAACACAGATGAT GTCAACGCCATCATCCTGGCCCAGAAGAACATGCTGGACCGCTTTGAGAAGACCAATGAGATGCTGCTC AACTTCAACAACCTGTCCAGTGCCCGCCTGCAGCAGATGAGCGAACGCTTCCTGCACCACACGAGGACC CTAGTAGAGATGAAACGGGACCTGGACAGCATCTTCCGCCGTATCAGGACGCTGAAAGGGAAACTGGCC AGGCAGCACCCAGAGGCCTTCAGCCATATCCCAGAGGCATCCTTCCTGGAGGAAGAGGATGAAGACCCC ATCCCACCCAGCACCACGACCACCATTGCCACCTCAGAACAGAGCACGGGCTCATGTGACACCAGCCCC GACACCGTCTCGCCCTCCCTGAGCCCCGGCTTCGAGGACCTGTCCCATGTCCAGCCTGGCTCCCCAGCC ATCAACGGCCGCAGCCAGACAGATGACGAGGAGATGACGGGCGAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001171948 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001171948.1 |
RefSeq Size | 1592 bp |
RefSeq ORF | 531 bp |
Locus ID | 79036 |
UniProt ID | Q9BQD3 |
MW | 19.7 kDa |
Gene Summary | As part of the BORC complex may play a role in lysosomes movement and localization at the cell periphery. Associated with the cytosolic face of lysosomes, the BORC complex may recruit ARL8B and couple lysosomes to microtubule plus-end-directed kinesin motor (PubMed:25898167). May be involved in the biogenesis of lysosome-related organelles such as melanosomes (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229637 | KXD1 (Myc-DDK-tagged)-Human chromosome 19 open reading frame 50 (C19orf50), transcript variant 1 |
CNY 2,400.00 |
|
RC229637L3 | Lenti ORF clone of Human chromosome 19 open reading frame 50 (C19orf50), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229637L4 | Lenti ORF clone of Human chromosome 19 open reading frame 50 (C19orf50), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG229637 | KXD1 (tGFP-tagged) - Human chromosome 19 open reading frame 50 (C19orf50), transcript variant 1 |
CNY 4,370.00 |
其它C19orf50产品