United States
Germany
Japan
United Kingdom
China
FNDC5 (NM_001171940) Human Untagged Clone
CAT＃: SC328173
FNDC5 (untagged)-Human fibronectin type III domain containing 5 (FNDC5) transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FRCP2; irisin |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001171940, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGCTTCATCCAGGAGGTGAACACCACCACCCGCTCATGTGCCCTCTGGGACCTG GAGGAGGATACGGAGTACATAGTCCACGTGCAGGCCATCTCCATTCAGGGCCAGAGCCCA GCCAGCGAGCCTGTGCTCTTCAAGACCCCGCGTGAGGCTGAGAAGATGGCCTCCAAGAAC AAAGATGAGGTAACCATGAAAGAGATGGGGAGGAACCAACAGCTGCGGACAGGCGAGGTG CTGATCATCGTCGTGGTCCTGTTCATGTGGGCAGGTGTCATTGCCCTCTTCTGCCGCCAG TATGACATCATTGAAGCGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001171940 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001171940.1, NP_001165411.2 |
| RefSeq Size | 2099 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 252995 |
| UniProt ID | Q8NAU1 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a secreted protein that is released from muscle cells during exercise. The encoded protein may participate in the development of brown fat. Translation of the precursor protein initiates at a non-AUG start codon at a position that is conserved as an AUG start codon in other organisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (3) contains multiple differences in the UTRs and coding region, compared to variant 1. It initiates translation from an alternate 'AUA' start codon that is conserved as an 'AUG' start codon in orthologs. The encoded isoform (3) is longer and has distinct N- and C-termini, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229535 | FNDC5 (Myc-DDK-tagged)-Human fibronectin type III domain containing 5 (FNDC5), transcript variant 3 |
CNY 3,990.00 |
|
| RC229535L3 | Lenti-ORF clone of FNDC5 (Myc-DDK-tagged)-Human fibronectin type III domain containing 5 (FNDC5), transcript variant 3 |
CNY 5,890.00 |
|
| RC229535L4 | Lenti-ORF clone of FNDC5 (mGFP-tagged)-Human fibronectin type III domain containing 5 (FNDC5), transcript variant 3 |
CNY 5,890.00 |
|
| RG229535 | FNDC5 (tGFP-tagged) - Human fibronectin type III domain containing 5 (FNDC5), transcript variant 3 |
CNY 4,370.00 |
