Kir7.1 (KCNJ13) (NM_001172416) Human Untagged Clone
CAT#: SC328160
KCNJ13 (untagged)-Human potassium inwardly-rectifying channel subfamily J member 13 (KCNJ13) transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KIR1.4; KIR7.1; LCA16; SVD |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172416, the custom clone sequence may differ by one or more nucleotides
ATGGACAGCAGTAATTGCAAAGTTATTGCTCCTCTCCTAAGTCAAAGATACCGGAGGATG GTCACCAAGGATGGCCACAGCACACTTCAAATGGATGGCGCTCAAAGAGGTCTTGCATAT CTTCGAGATGCTTGGGGAATCCTAATGGACATGCGCTGGCGTTGGATGATGTTGGTCTTT TCTGCTTCTTTTGTTGTCCACTGGCTTGTCTTTGCAGTGCTCTGGTGCTTTTGTGGCGAA GATTGCCCGGCCAAAAAATCGAGCTTTTTCAATTCGCTTTACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001172416 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001172416.1, NP_001165887.1 |
RefSeq Size | 3373 bp |
RefSeq ORF | 285 bp |
Locus ID | 3769 |
UniProt ID | O60928 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | This gene encodes a member of the inwardly rectifying potassium channel family of proteins. Members of this family form ion channel pores that allow potassium ions to pass into a cell. The encoded protein belongs to a subfamily of low signal channel conductance proteins that have a low dependence on potassium concentration. Mutations in this gene are associated with snowflake vitreoretinal degeneration. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229522 | KCNJ13 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 13 (KCNJ13), transcript variant 2 |
CNY 3,990.00 |
|
RC229522L3 | Lenti-ORF clone of KCNJ13 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 13 (KCNJ13), transcript variant 2 |
CNY 5,890.00 |
|
RC229522L4 | Lenti-ORF clone of KCNJ13 (mGFP-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 13 (KCNJ13), transcript variant 2 |
CNY 5,890.00 |
|
RG229522 | KCNJ13 (tGFP-tagged) - Human potassium inwardly-rectifying channel, subfamily J, member 13 (KCNJ13), transcript variant 2 |
CNY 4,370.00 |