BLCAP (NM_001167820) Human Untagged Clone

CAT#: SC328156

BLCAP (untagged)-Human bladder cancer associated protein (BLCAP) transcript variant 2



  "NM_001167820" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-BLCAP antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BC10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001167820, the custom clone sequence may differ by one or more nucleotides
ATGTATTGCCTCCAGTGGCTGCTGCCCGTCCTCCTCATCCCCAAGCCCCTCAACCCCGCC
CTGTGGTTCAGCCACTCCATGTTCATGGGCTTCTACCTGCTCAGCTTCCTCCTGGAACGG
AAGCCTTGCACAATTTGTGCCTTGGTTTTCCTGGCAGCCCTGTTCCTTATCTGCTATAGC
TGCTGGGGAAACTGTTTCCTGTACCACTGCTCCGATTCCCCGCTTCCAGAATCGGCGCAT
GATCCCGGCGTTGTGGGCACCTAA
Restriction Sites Please inquire     
ACCN NM_001167820
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001167820.1, NP_001161292.1
RefSeq Size 2216 bp
RefSeq ORF 264 bp
Locus ID 10904
UniProt ID P62952
Protein Families Transmembrane
Gene Summary This gene encodes a protein that reduces cell growth by stimulating apoptosis. Alternative splicing and the use of alternative promoters result in multiple transcript variants encoding the same protein. This gene is imprinted in brain where different transcript variants are expressed from each parental allele. Transcript variants initiating from the upstream promoter are expressed preferentially from the maternal allele, while transcript variants initiating downstream of the interspersed NNAT gene (GeneID:4826) are expressed from the paternal allele. Transcripts at this locus may also undergo A to I editing, resulting in amino acid changes at three positions in the N-terminus of the protein. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (6, also known as V1c) differs in the 5' UTR compared to variant 1. This variant may be expressed predominantly from the maternal allele in brain (PMID:18836209). Variants 1 to 7 all encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...