PRRG1 (NM_001173486) Human Untagged Clone
CAT#: SC328147
PRRG1 (untagged)-Human proline rich Gla (G-carboxyglutamic acid) 1 (PRRG1) transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PRGP1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001173486, the custom clone sequence may differ by one or more nucleotides
ATGGGGAGGGTTTTCCTCACGGGAGAAAAAGCCAATTCCATATTAAAACGCTACCCAAGA GCTAATGGGTTTTTTGAAGAAATAAGACAGGGCAACATTGAGCGTGAGTGCAAAGAAGAA TTCTGTACATTTGAAGAAGCAAGAGAAGCTTTTGAAAATAATGAAAAAACTGGTCTTGTT CTGTTGCCAAGGCTGGAGTGCAGCTGTGAACATGGCTCATTGCAGCCTCAACTTCCTGTG CCCAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001173486 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173486.1, NP_001166957.1 |
RefSeq Size | 1783 bp |
RefSeq ORF | 249 bp |
Locus ID | 5638 |
UniProt ID | O14668 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a vitamin K-dependent, gamma-carboxyglutamic acid (Gla)-containing, single-pass transmembrane protein. This protein contains a Gla domain at the N-terminus, preceded by a propeptide sequence required for post-translational gamma-carboxylation of specific glutamic acid residues by a vitamin K-dependent gamma-carboxylase. The C-terminus is proline-rich containing PPXY and PXXP motifs found in a variety of signaling and cytoskeletal proteins. This gene is highly expressed in the spinal cord. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (5) is missing a 5' non-coding exon, and contains an alternate 3' terminal exon compared to variant 1. The latter causes a frame-shift and a shorter isoform (2) with a distinct C-terminus compared to isoform 1. Isoform 2 retains a partial Gla domain at the N-terminus, however, this protein is predicted and lacks experimental evidence. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229509 | PRRG1 (Myc-DDK-tagged)-Human proline rich Gla (G-carboxyglutamic acid) 1 (PRRG1), transcript variant 5 |
CNY 3,990.00 |
|
RC229509L3 | Lenti-ORF clone of PRRG1 (Myc-DDK-tagged)-Human proline rich Gla (G-carboxyglutamic acid) 1 (PRRG1), transcript variant 5 |
CNY 5,890.00 |
|
RC229509L4 | Lenti-ORF clone of PRRG1 (mGFP-tagged)-Human proline rich Gla (G-carboxyglutamic acid) 1 (PRRG1), transcript variant 5 |
CNY 5,890.00 |
|
RG229509 | PRRG1 (tGFP-tagged) - Human proline rich Gla (G-carboxyglutamic acid) 1 (PRRG1), transcript variant 5 |
CNY 4,370.00 |