United States
Germany
Japan
United Kingdom
China
EAAT1 (SLC1A3) (NM_001166696) Human Untagged Clone
CAT＃: SC328132
SLC1A3 (untagged)-Human solute carrier family 1 (glial high affinity glutamate transporter) member 3 (SLC1A3) transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EA6; EAAT1; GLAST; GLAST1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001166696, the custom clone sequence may differ by one or more nucleotides
ATGACTAAAAGCAATGGAGAAGAGCCCAAGATGGGGGGCAGGATGGAGAGATTCCAGCAG GGAGTCCGTAAACGCACACTTTTGGCCAAGAAGAAAGTGCAGAACATTACAAAGGAGGAT GTTAAAAGTTACCTGTTTCGGAATGCTTTTGTGCTGCTCACAGTCACCGCTGTCATTGTG GGTGAGTCATTTGATTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001166696 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001166696.1, NP_001160168.1 |
| RefSeq Size | 1376 bp |
| RefSeq ORF | 198 bp |
| Locus ID | 6507 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a member of a member of a high affinity glutamate transporter family. This gene functions in the termination of excitatory neurotransmission in central nervous system. Mutations are associated with episodic ataxia, Type 6. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2014] Transcript Variant: This variant (3) differs in the 3' UTR and has multiple coding differences compared to variant GLAST. The encoded protein (isoform 3) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229494 | SLC1A3 (Myc-DDK-tagged)-Human solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), transcript variant 3 |
CNY 1,920.00 |
|
| RC229494L3 | Lenti-ORF clone of SLC1A3 (Myc-DDK-tagged)-Human solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), transcript variant 3 |
CNY 5,890.00 |
|
| RC229494L4 | Lenti-ORF clone of SLC1A3 (mGFP-tagged)-Human solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), transcript variant 3 |
CNY 5,890.00 |
|
| RG229494 | SLC1A3 (tGFP-tagged) - Human solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), transcript variant 3 |
CNY 3,520.00 |
