HOXD9 (NM_014213) Human Untagged Clone

CAT#: SC327803

HOXD9 (untagged)-Human homeobox D9 (HOXD9)



  "NM_014213" in other vectors (5)

CNY 7,220.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
HOXD9 mouse monoclonal antibody,clone OTI1H3
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Hox-4.3; Hox-5.2; HOX4; HOX4C
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_014213, the custom clone sequence may differ by one or more nucleotides
ATGTTGGGTGGGAGTGCGGGACGCCTCAAAATGTCTTCCAGTGGCACCCTCAGCAACTAC
TACGTGGACTCGCTTATAGGCCATGAGGGCGACGAGGTGTTCGCGGCGCGCTTCGGGCCG
CCGGGGCCAGGCGCGCAGGGCCGGCCTGCAGGTGTGGCTGATGGCCCGGCCGCCACCGCC
GCCGAGTTCGCCTCGTGTAGTTTTGCCCCCAGATCGGCCGTGTTCTCTGCCTCGTGGTCC
GCGGTGCCCTCCCAGCCCCCGGCAGCGGCGGCGATGAGCGGCCTCTACCACCCGTACGTT
CCCCCGCCGCCCCTGGCCGCCTCTGCCTCCGAGCCCGGCCGCTACGTGCGCTCCTGGATG
GAGCCGCTGCCCGGCTTCCCGGGCGGTGCGGGCGGTGGCGGTGGTGGTGGAGGCGGCGGT
CCGGGCCGCGGTCCCAGCCCTGGCCCCAGCGGCCCAGCCAACGGGCGCCACTACGGGATT
AAGCCTGAAACCCGAGCGGCCCCGGCCCCCGCCACGGCCGCCTCCACCACCTCCTCCTCC
TCCACTTCCTTATCCTCCTCCTCCAAACGGACTGAGTGCTCCGTGGCCCGGGAGTCCCAG
GGGAGCAGCGGCCCCGAGTTCTCGTGCAACTCGTTCCTGCAGGAGAAGGCGGCAGCGGCG
ACGGGGGGAACCGGGCCTGGGGCAGGGATCGGGGCCGCGACTGGGACGGGCGGCTCGTCG
GAGCCCTCAGCTTGCAGCGACCACCCGATCCCAGGCTGTTCGCTGAAGGAGGAGGAGAAG
CAGCATTCGCAGCCGCAGCAGCAGCAACTTGACCCAAACAACCCCGCCGCGAACTGGATC
CACGCTCGCTCCACCCGGAAAAAGCGCTGTCCCTACACCAAATACCAGACGCTTGAGCTG
GAGAAAGAATTCCTCTTCAACATGTACCTCACCCGGGACCGGCGCTACGAGGTGGCCAGG
ATTCTCAACCTAACAGAGAGACAGGTCAAAATCTGGTTTCAGAACCGTAGGATGAAAATG
AAAAAGATGAGCAAGGAGAAATGCCCCAAAGGAGAC
Restriction Sites Please inquire     
ACCN NM_014213
Insert Size 1902 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014213.3, NP_055028.3
RefSeq Size 1902 bp
RefSeq ORF 1902 bp
Locus ID 3235
UniProt ID P28356
Protein Families Transcription Factors
Gene Summary This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...