United States
Germany
Japan
United Kingdom
China
Slap (SLA) (NM_006748) Human Untagged Clone
CAT＃: SC327788
SLA (untagged)-Human Src-like-adaptor (SLA) transcript variant 3
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SLA1; SLAP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_006748, the custom clone sequence may differ by one or more nucleotides
ATGCTCTCTAAACTGGGTCATTCTCCACTTGGAGGGCTCAGGGCACGGTTGACTTTCCCC GTCTGTCTCCTATACCACAGGCTCTGGGCATCACCAGCGGCCCCAGGGAAAAAGAAAGAA ATGGGAAACAGCATGAAATCCACCCCTGCGCCTGCCGAGAGGCCCCTGCCCAACCCGGAG GGACTGGATAGCGACTTCCTTGCCGTGCTAAGTGACTACCCGTCTCCTGACATCAGCCCC CCGATATTCCGCCGAGGGGAGAAACTGCGTGTGATTTCTGATGAAGGGGGCTGGTGGAAA GCTATTTCTCTTAGCACTGGTCGAGAGAGTTACATCCCTGGAATATGTGTGGCCAGAGTT TACCATGGCTGGCTGTTTGAGGGCCTGGGCAGAGACAAGGCCGAGGAGCTGCTGCAGCTG CCAGACACAAAGGTCGGCTCCTTCATGATCAGAGAGAGTGAGACCAAGAAAGGGTTTTAC TCACTGTCGGTGAGACACAGGCAGGTAAAGCATTACCGCATTTTCCGTCTGCCCAACAAC TGGTACTACATTTCCCCGAGGCTCACCTTCCAGTGCCTGGAGGACCTGGTGAACCACTAT TCTGAGGTGGCTGATGGCCTGTGCTGTGTGCTCACCACGCCCTGCCTGACACAAAGCACG GCTGCCCCAGCAGTGAGGGCCTCCAGCTCACCTGTCACCTTGCGTCAGAAGACTGTGGAC TGGAGGAGAGTGTCCAGACTGCAGGAGGACCCCGAGGGAACAGAGAACCCGCTTGGGGTA GACGAGTCCCTTTTCAGCTATGGCCTTCGAGAGAGCATTGCCTCTTACCTGTCCCTGACC AGTGAGGACAACACCTCCTTTGATCGAAAGAAGAAAAGCATCTCCCTGATGTATGGTGGC AGCAAGAGAAAGAGCTCATTCTTCTCATCACCACCTTACTTTGAGGAC |
| Restriction Sites | Please inquire |
| ACCN | NM_006748 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006748.3, NP_006739.2 |
| RefSeq Size | 2872 bp |
| RefSeq ORF | 951 bp |
| Locus ID | 6503 |
| UniProt ID | Q13239 |
| Domains | SH2, SH3 |
| Protein Families | Druggable Genome |
| Gene Summary | Adapter protein, which negatively regulates T-cell receptor (TCR) signaling. Inhibits T-cell antigen-receptor induced activation of nuclear factor of activated T-cells. Involved in the negative regulation of positive selection and mitosis of T-cells. May act by linking signaling proteins such as ZAP70 with CBL, leading to a CBL dependent degradation of signaling proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (c) is longer at the N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223060 | SLA (Myc-DDK-tagged)-Human Src-like-adaptor (SLA), transcript variant 3 |
CNY 3,990.00 |
|
| RC223060L3 | Lenti-ORF clone of SLA (Myc-DDK-tagged)-Human Src-like-adaptor (SLA), transcript variant 3 |
CNY 5,890.00 |
|
| RC223060L4 | Lenti-ORF clone of SLA (mGFP-tagged)-Human Src-like-adaptor (SLA), transcript variant 3 |
CNY 5,890.00 |
|
| RG223060 | SLA (tGFP-tagged) - Human Src-like-adaptor (SLA), transcript variant 3 |
CNY 4,370.00 |
|
| SC115905 | SLA (untagged)-Human Src-like-adaptor (SLA), transcript variant 3 |
CNY 2,400.00 |
