CCNQ (NM_152274) Human Untagged Clone
CAT#: SC327767
FAM58A (untagged)-Human family with sequence similarity 58 member A (FAM58A) transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CycM; FAM58A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327767 representing NM_152274.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGCCCCGGAGGGCGGCGGAGGGGGGCCTGCAGCGCGGGGCCCGGAGGGGCAGCCGGCGCCCGAA GCCAGGGTGCACTTCCGAGTGGCGAGGTTCATCATGGAGGCAGGTGTCAAGCTAGGGATGCGGTCCATT CCCATTGCCACTGCTTGCACCATTTACCATAAGTTCTTTTGCGAGACCAACCTGGACGCCTATGACCCT TACCTGATTGCCATGTCTTCAATTTACTTGGCCGGCAAAGTGGAAGAGCAGCACCTGCGGACTCGTGAC ATCATCAATGTGTCCAACAGGTACTTTAACCCAAGCGGTGAGCCCCTGGAATTGGACTCCCGCTTCTGG GAACTCCGGGACAGCATCGTGCAGTGTGAGCTTCTCATGCTGAGAGTTCTGCGCTTCCAGGTCTCCTTC CAGCATCCACACAAGTACCTGCTCCACTACCTGGTTTCCCTCCAGAACTGGCTGAACCGCCACAGCTGG CAGCGGACCCCTGTTGCCGTCACCGCCTGGGCCCTGCTGCGGGACAGCTACCATGGGGCGCTGTGCCTC CGCTTCCAGGCCCAGCACATCGCCGTGGCGGTGCTCTACCTGGCCCTGCAGGTCTACGGAGTTGAGGTG CCCGCCGAGGTCGAGGCTGAGAAGCCGTGGTGGCAGGTGTTTAATGACGACCTTACCAAGCCAATCATT GATAATATTGTGTCTGATCTCATTCAGATTTATACCATGGACACAGAGATCCCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_152274 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_152274.4 |
RefSeq Size | 1324 bp |
RefSeq ORF | 747 bp |
Locus ID | 92002 |
UniProt ID | Q8N1B3 |
Domains | CYCLIN, cyclin |
MW | 28.4 kDa |
Gene Summary | Mutations in this gene have been shown to cause an X-linked dominant STAR syndrome that typically manifests syndactyly, telecanthus and anogenital and renal malformations. The protein encoded by this gene contains a cyclin-box-fold domain which suggests it may have a role in controlling nuclear cell division cycles. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205728 | FAM58A (Myc-DDK-tagged)-Human family with sequence similarity 58, member A (FAM58A), transcript variant 1 |
CNY 2,400.00 |
|
RC205728L3 | Lenti ORF clone of Human family with sequence similarity 58, member A (FAM58A), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205728L4 | Lenti ORF clone of Human family with sequence similarity 58, member A (FAM58A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG205728 | FAM58A (tGFP-tagged) - Human family with sequence similarity 58, member A (FAM58A), transcript variant 1 |
CNY 4,370.00 |
|
SC100474 | FAM58A (untagged)-Human family with sequence similarity 58, member A (FAM58A), transcript variant 1 |
CNY 2,400.00 |
|
SC324502 | FAM58A (untagged)-Human family with sequence similarity 58, member A (FAM58A), transcript variant 1 |
CNY 2,400.00 |