RBP1 (NM_002899) Human Untagged Clone
CAT#: SC327754
RBP1 (untagged)-Human retinol binding protein 1 cellular (RBP1) transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRABP-I; CRBP; CRBP1; CRBPI; RBPC |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002899 edited
CTAAGCGGGGAGGAGCGACCGCTACAATGGATCCTCCCGCAGGCTTTGTGCGCGCTGGGA ATCCAGCTGTCGCCGCCCCGCAGAGCCCCCTGTCCCCGGAGGGCGCTCATTTCCGGGCCG CCCACCACCCGCGTAGCACCGGCAGCCGCTGTCCCGGCAGTCTCCAGCCGTCCCGTCCGC TTGTGGCCAACTGGCTCCAGTCACTCCCCGAAATGCCAGTCGACTTCACTGGGTACTGGA AGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCT TGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATA TGATCATCCGCACGCTGAGCACTTTTAGGAACTACATCATGGACTTCCAGGTTGGGAAGG AGTTTGAGGAGGATCTGACAGGCATAGATGACCGCAAGTGCATGACAACAGTGAGCTGGG ACGGAGACAAGCTCCAGTGTGTGCAGAAGGGTGAGAAGGAGGGGCGTGGCTGGACCCAGT GGATCGAGGGTGATGAGCTGCACCTGGAGATGAGAGTGGAAGGTGTGGTCTGCAAGCAAG TATTCAAGAAGGTGCAGTGAGGCCCAGGCAGACAACCTTGTCCCAAGGAATCAGCAGGAT GTGTGGGCCAGGATCCCCCTCTTTGCACAGCATGAGGCAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002899 |
Insert Size | 916 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002899.3, NP_002890.2 |
RefSeq Size | 916 bp |
RefSeq ORF | 594 bp |
Locus ID | 5947 |
UniProt ID | P09455 |
Gene Summary | This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214515 | RBP1 (Myc-DDK-tagged)-Human retinol binding protein 1, cellular (RBP1), transcript variant 1 |
CNY 1,200.00 |
|
RC214515L1 | Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214515L2 | Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC214515L3 | Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214515L4 | Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, mGFP tagged |
CNY 3,600.00 |
|
RG214515 | RBP1 (tGFP-tagged) - Human retinol binding protein 1, cellular (RBP1), transcript variant 1 |
CNY 2,800.00 |
|
SC303248 | RBP1 (untagged)-Human retinol binding protein 1, cellular (RBP1), transcript variant 1 |
CNY 1,200.00 |