MIER1 (NM_001146113) Human Untagged Clone
CAT#: SC327487
MIER1 (untagged)-Human mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1) transcript variant 9
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ER1; MI-ER1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146113, the custom clone sequence may differ by one or more nucleotides
ATGCCAATTCATGAACTTCTCAGCCTTTATGGTTATGGTAGTACTGTTCGACTACCTGAA GAAGATGAGGAAGAGGAAGAAGAGGAAGAAGAAGGTGAAGATGATGAAGATGCTGATAAT GATGACAACAGTGGCTGTAGTGGGGAAAATAAAGAGGAGAATATAAAGGATTCATCAGGT CAGGAGGATGAAACTCAGTCTTCCAATGATGATCCATCACAATCTGTTGCTTCTCAAGAT GCCCAGGAAATAATCCGCCCACGTCGATGTAAATATTTTGATACAAATAGTGAAGTAGAA GAAGAATCTGAAGAAGATGAAGATTATATTCCATCAGAAGACTGGAAAAAGGAGATTATG GTGGGCTCCATGTTTCAAGCAGAAATTCCAGTTGGCATTTGTAGATACAAAGAAAATGAA AAAGTATATGAAAATGATGATCAGCTCCTGTGGGACCCTGAGTACTTACCAGAAGATAAA GTGATTATATTTCTTAAAGATGCATCTAGAAGAACAGGTGATGAGAAGGGTGTAGAAGCA ATTCCTGAAGGATCTCACATAAAAGACAATGAACAGGCTTTATATGAATTGGTTAAATGC AATTTTGATACAGAAGAAGCATTGAGAAGATTAAGATTTAATGTAAAAGCAGCTAGAGAG GAATTATCTGTTTGGACAGAGGAAGAGTGTAGAAATTTTGAACAAGGGCTGAAGGCCTAT GGAAAGGATTTTCATTTGATTCAGGCTAATAAAGTCCGAACAAGGTCAGTTGGTGAATGT GTAGCATTCTATTACATGTGGAAAAAATCTGAACGTTATGATTTCTTTGCTCAGCAAACA CGATTTGGAAAGAAGAAATATAATCTTCATCCTGGTGTAACGGATTACATGGATCGTCTT CTAGACGAAAGTGAAAGTGCTGCATCTAGTCGAGCACCATCCCCTCCCCCAACTGCATCA AACAGTAGTAACAGCCAGTCTGAGAAAGAAGATGGCACTGTAAGCACTGCTAATCAAAAT GGAGTGTCATCTAATGGACCAGGCATACTCCAAATGCTTCTTCCAGTTCATTTTTCAGCC ATCAGTTCAAGAGCCAATGCCTTTTTAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001146113 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146113.1, NP_001139585.1 |
RefSeq Size | 3613 bp |
RefSeq ORF | 1113 bp |
Locus ID | 57708 |
UniProt ID | Q8N108 |
Gene Summary | This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013] Transcript Variant: This variant (9) lacks two alternate exons in the 5' coding region, initiates translation at a downsteram in-frame start codon, and lacks an alternate segment in the 3' coding region, compared to variant 1. The resulting isoform (i) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228852 | MIER1 (Myc-DDK-tagged)-Human mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1), transcript variant 9 |
CNY 3,990.00 |
|
RC228852L3 | Lenti-ORF clone of MIER1 (Myc-DDK-tagged)-Human mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1), transcript variant 9 |
CNY 5,890.00 |
|
RC228852L4 | Lenti-ORF clone of MIER1 (mGFP-tagged)-Human mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1), transcript variant 9 |
CNY 5,890.00 |
|
RG228852 | MIER1 (tGFP-tagged) - Human mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1), transcript variant 9 |
CNY 4,370.00 |