SH2D2A (NM_001161443) Human Untagged Clone
CAT#: SC327479
SH2D2A (untagged)-Human SH2 domain protein 2A (SH2D2A) transcript variant 4
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | F2771; SCAP; TSAD; VRAP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161443, the custom clone sequence may differ by one or more nucleotides
ATGACCCGCAGGAGCTGCCAGAACCTGGGCTACACTGCGGCATCTCCCCAGGCCCCGGAG GCTGCCTCCAACACAGGGAATGCTGAGAGGGCAGAGGAGGTGCCTGGAGAAGGAAGCCTG TTCCTGCAGGCCGAGACCCGGGCTTGGTTCCAGAAGACCCAGGCCCACTGGCTCCTGCAG CACGGGGCAGCCCCTGCCTGGTTCCATGGCTTCATCACCCGGAGGGAGGCAGAGAGGCTG CTGGAGCCCAAGCCTCAGGGGTGCTACTTGGTGCGGTTCAGCGAGAGCGCGGTGACCTTC GTGCTGACTTACAGGAGCCGGACTTGCTGCCGCCACTTCCTGCTGGCCCAGCTCAGGGAC GGGCGCCACGTGGTGCTGGGCGAGGACAGCGCCCACGCGCGGCTGCAGGACCTGCTGCTG CACTACACCGCGCACCCGCTCAGCCCCTACGGGGAGACGCTCACCGAGCCCCTCGCCCGA CAGACTCCTGAGCCTGCAGGACTTTCCCTGAGGACCGAAGAATCAAACTTTGGAAGCAAA AGCCAGGACCCAAACCCCCAGTACAGCCCAATCATCAAACAGGGGCAAGCCCCAGTCCCG ATGCAGAAAGAGGGGGCCGGGGAGAAGGAGCCCTCCCAGCTGCTCAGGCCCAAGCCTCCC ATCCCCGCCAAACCTCAGCTGCCCCCAGAAGTCTACACAATCCCTGTTCCACGACACCGC CCGGCCCCACGCCCCAAGCCCTCCAATCCTATCTACAATGAGCCTGATGAACCCATAGCT TTCTATGCCATGGGCCGGGGCAGCCCTGGGGAAGCCCCCAGCAACATCTATGTGGAAGTG GAAGATGAGGGCCTACCCGCCACCCTTGGGCACCCTGTCCTACGGAAGAGCTGGTCCAGG CCTGTCCCAGGAGGCCAGAATACAGGTGGCTCCCAGCTGCATTCTGAGAACTCTGTGATT GGGCAAGGCCCTCCCCTGCCCCACCAGCCCCCACCCGCCTGGAGACACACCCTCCCCCAC AATCTTTCTAGACAGGTGCTTCAGGACAGAGGACAGGCATGGCTTCCCCTTGGGCCTCCT CAG |
Restriction Sites | Please inquire |
ACCN | NM_001161443 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001161443.1, NP_001154915.1 |
RefSeq Size | 1540 bp |
RefSeq ORF | 1086 bp |
Locus ID | 9047 |
Protein Pathways | VEGF signaling pathway |
Gene Summary | This gene encodes an adaptor protein thought to function in T-cell signal transduction. A related protein in mouse is responsible for the activation of lymphocyte-specific protein-tyrosine kinase and functions in downstream signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (4) differs in the 5' UTR, has multiple differences in the coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228844 | SH2D2A (Myc-DDK-tagged)-Human SH2 domain containing 2A (SH2D2A), transcript variant 4 |
CNY 3,990.00 |
|
RC228844L3 | Lenti-ORF clone of SH2D2A (Myc-DDK-tagged)-Human SH2 domain containing 2A (SH2D2A), transcript variant 4 |
CNY 5,890.00 |
|
RC228844L4 | Lenti-ORF clone of SH2D2A (mGFP-tagged)-Human SH2 domain containing 2A (SH2D2A), transcript variant 4 |
CNY 5,890.00 |
|
RG228844 | SH2D2A (tGFP-tagged) - Human SH2 domain containing 2A (SH2D2A), transcript variant 4 |
CNY 4,370.00 |