GPR17 (NM_001161417) Human Untagged Clone

CAT#: SC327463

GPR17 (untagged)-Human G protein-coupled receptor 17 (GPR17) transcript variant 4



  "NM_001161417" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GPR17 mouse monoclonal antibody,clone OTI17C1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001161417, the custom clone sequence may differ by one or more nucleotides
ATGAATGGCCTTGAAGTGGCTCCCCCAGGTCTGATCACCAACTTCTCCCTGGCCACGGCA
GAGCAATGTGGCCAGGAGACGCCACTGGAGAACATGCTGTTCGCCTCCTTCTACCTTCTG
GATTTTATCCTGGCTTTAGTTGGCAATACCCTGGCTCTGTGGCTTTTCATCCGAGACCAC
AAGTCCGGGACCCCGGCCAACGTGTTCCTGATGCATCTGGCCGTGGCCGACTTGTCGTGC
GTGCTGGTCCTGCCCACCCGCCTGGTCTACCACTTCTCTGGGAACCACTGGCCATTTGGG
GAAATCGCATGCCGTCTCACCGGCTTCCTCTTCTACCTCAACATGTACGCCAGCATCTAC
TTCCTCACCTGCATCAGCGCCGACCGTTTCCTGGCCATTGTGCACCCGGTCAAGTCCCTC
AAGCTCCGCAGGCCCCTCTACGCACACCTGGCCTGTGCCTTCCTGTGGGTGGTGGTGGCT
GTGGCCATGGCCCCGCTGCTGGTGAGCCCACAGACCGTGCAGACCAACCACACGGTGGTC
TGCCTGCAGCTGTACCGGGAGAAGGCCTCCCACCATGCCCTGGTGTCCCTGGCAGTGGCC
TTCACCTTCCCGTTCATCACCACGGTCACCTGCTACCTGCTGATCATCCGCAGCCTGCGG
CAGGGCCTGCGTGTGGAGAAGCGCCTCAAGACCAAGGCAGTGCGCATGATCGCCATAGTG
CTGGCCATCTTCCTGGTCTGCTTCGTGCCCTACCACGTCAACCGCTCCGTCTACGTGCTG
CACTACCGCAGCCATGGGGCCTCCTGCGCCACCCAGCGCATCCTGGCCCTGGCAAACCGC
ATCACCTCCTGCCTCACCAGCCTCAACGGGGCACTCGACCCCATCATGTATTTCTTCGTG
GCTGAGAAGTTCCGCCACGCCCTGTGCAACTTGCTCTGTGGCAAAAGGCTCAAGGGCCCG
CCCCCCAGCTTCGAAGGGAAAACCAACGAGAGCTCGCTGAGTGCCAAGTCAGAGCTG
Restriction Sites Please inquire     
ACCN NM_001161417
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001161417.1, NP_001154889.1
RefSeq Size 2315 bp
RefSeq ORF 1020 bp
Locus ID 2840
UniProt ID Q13304
Protein Families Druggable Genome, GPCR, Transmembrane
Gene Summary Dual specificity receptor for uracil nucleotides and cysteinyl leukotrienes (CysLTs). Signals through G(i) and inhibition of adenylyl cyclase. May mediate brain damage by nucleotides and CysLTs following ischemia.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Both variants 3 and 4 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...