United States
Germany
Japan
United Kingdom
China
GPR17 (NM_001161417) Human Untagged Clone
CAT＃: SC327463
GPR17 (untagged)-Human G protein-coupled receptor 17 (GPR17) transcript variant 4
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001161417, the custom clone sequence may differ by one or more nucleotides
ATGAATGGCCTTGAAGTGGCTCCCCCAGGTCTGATCACCAACTTCTCCCTGGCCACGGCA GAGCAATGTGGCCAGGAGACGCCACTGGAGAACATGCTGTTCGCCTCCTTCTACCTTCTG GATTTTATCCTGGCTTTAGTTGGCAATACCCTGGCTCTGTGGCTTTTCATCCGAGACCAC AAGTCCGGGACCCCGGCCAACGTGTTCCTGATGCATCTGGCCGTGGCCGACTTGTCGTGC GTGCTGGTCCTGCCCACCCGCCTGGTCTACCACTTCTCTGGGAACCACTGGCCATTTGGG GAAATCGCATGCCGTCTCACCGGCTTCCTCTTCTACCTCAACATGTACGCCAGCATCTAC TTCCTCACCTGCATCAGCGCCGACCGTTTCCTGGCCATTGTGCACCCGGTCAAGTCCCTC AAGCTCCGCAGGCCCCTCTACGCACACCTGGCCTGTGCCTTCCTGTGGGTGGTGGTGGCT GTGGCCATGGCCCCGCTGCTGGTGAGCCCACAGACCGTGCAGACCAACCACACGGTGGTC TGCCTGCAGCTGTACCGGGAGAAGGCCTCCCACCATGCCCTGGTGTCCCTGGCAGTGGCC TTCACCTTCCCGTTCATCACCACGGTCACCTGCTACCTGCTGATCATCCGCAGCCTGCGG CAGGGCCTGCGTGTGGAGAAGCGCCTCAAGACCAAGGCAGTGCGCATGATCGCCATAGTG CTGGCCATCTTCCTGGTCTGCTTCGTGCCCTACCACGTCAACCGCTCCGTCTACGTGCTG CACTACCGCAGCCATGGGGCCTCCTGCGCCACCCAGCGCATCCTGGCCCTGGCAAACCGC ATCACCTCCTGCCTCACCAGCCTCAACGGGGCACTCGACCCCATCATGTATTTCTTCGTG GCTGAGAAGTTCCGCCACGCCCTGTGCAACTTGCTCTGTGGCAAAAGGCTCAAGGGCCCG CCCCCCAGCTTCGAAGGGAAAACCAACGAGAGCTCGCTGAGTGCCAAGTCAGAGCTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001161417 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001161417.1, NP_001154889.1 |
| RefSeq Size | 2315 bp |
| RefSeq ORF | 1020 bp |
| Locus ID | 2840 |
| UniProt ID | Q13304 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Gene Summary | Dual specificity receptor for uracil nucleotides and cysteinyl leukotrienes (CysLTs). Signals through G(i) and inhibition of adenylyl cyclase. May mediate brain damage by nucleotides and CysLTs following ischemia.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Both variants 3 and 4 encode the same isoform (b). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228828 | GPR17 (Myc-DDK-tagged)-Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
CNY 3,656.00 |
|
| RC228828L3 | Lenti-ORF clone of GPR17 (Myc-DDK-tagged)-Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
CNY 5,890.00 |
|
| RC228828L4 | Lenti-ORF clone of GPR17 (mGFP-tagged)-Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
CNY 5,890.00 |
|
| RG228828 | GPR17 (tGFP-tagged) - Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
CNY 5,256.00 |
