United States
Germany
Japan
United Kingdom
China
NT5C3 (NT5C3A) (NM_001166118) Human Untagged Clone
CAT＃: SC327437
NT5C3 (untagged)-Human 5'-nucleotidase cytosolic III (NT5C3) transcript variant 4
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | cN-III; hUMP1; NT5C3; P5'N-1; P5N-1; p36; PN-I; POMP; PSN1; UMPH; UMPH1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001166118, the custom clone sequence may differ by one or more nucleotides
ATGCCAGAATTCCAGAAAAGTTCAGTTCGAATCAAGAACCCTACAAGAGTAGAAGAAATT ATCTGTGGTCTTATCAAAGGAGGAGCTGCCAAACTTCAGATAATAACGGACTTTGATATG ACACTCAGTAGATTTTCATATAAAGGGAAAAGATGCCCAACATGTCATAATATCATTGAC AACTGTAAGCTGGTTACAGATGAATGTAGAAAAAAGTTATTGCAACTAAAGGAAAAATAT TACGCTATTGAAGTTGATCCTGTTCTTACTGTAGAAGAGAAGTACCCTTATATGGTGGAA TGGTATACTAAATCACATGGTTTGCTTGTTCAGCAAGCTTTACCAAAAGCTAAACTTAAA GAAATTGTGGCAGAATCTGACGTTATGCTCAAAGAAGGATATGAGAATTTCTTTGATAAG CTCCAACAACATAGCATCCCCGTGTTCATATTTTCGGCTGGAATCGGCGATGTACTAGAG GAAGTTATTCGTCAAGCTGGTGTTTATCATCCCAATGTCAAAGTTGTGTCCAATTTTATG GATTTTGATGAAACTGGGGTGCTCAAAGGATTTAAAGGAGAACTAATTCATGTATTTAAC AAACATGATGGTGCCTTGAGGAATACAGAATATTTCAATCAACTAAAAGACAATAGTAAC ATAATTCTTCTGGGAGACTCCCAAGGAGACTTAAGAATGGCAGATGGAGTGGCCAATGTT GAGCACATTCTGAAAATTGGATATCTAAATGATAGAGTGGATGAGCTTTTAGAAAAGTAC ATGGACTCTTATGATATTGTTTTAGTACAAGATGAATCATTAGAAGTAGCCAACTCTATT TTACAGAAGATTCTA |
| Restriction Sites | Please inquire |
| ACCN | NM_001166118 |
| Insert Size | 1932 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001166118.1, NP_001159590.1 |
| RefSeq Size | 1932 bp |
| RefSeq ORF | 1932 bp |
| Locus ID | 51251 |
| UniProt ID | Q9H0P0 |
| Protein Families | Transmembrane |
| Protein Pathways | Metabolic pathways, Nicotinate and nicotinamide metabolism, Purine metabolism, Pyrimidine metabolism |
| Gene Summary | This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (4) differs in the 5' UTR, includes two alternate internal exons, and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 4 and 5 both encode the same isoform (3). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228802 | NT5C3 (Myc-DDK-tagged)-Human 5'-nucleotidase, cytosolic III (NT5C3), transcript variant 4 |
CNY 3,990.00 |
|
| RC228802L3 | Lenti-ORF clone of NT5C3 (Myc-DDK-tagged)-Human 5'-nucleotidase, cytosolic III (NT5C3), transcript variant 4 |
CNY 5,890.00 |
|
| RC228802L4 | Lenti-ORF clone of NT5C3 (mGFP-tagged)-Human 5'-nucleotidase, cytosolic III (NT5C3), transcript variant 4 |
CNY 5,890.00 |
|
| RG228802 | NT5C3 (tGFP-tagged) - Human 5'-nucleotidase, cytosolic III (NT5C3), transcript variant 4 |
CNY 4,370.00 |
