PLAAT5 (NM_001146729) Human Untagged Clone
CAT#: SC327426
HRASLS5 (untagged)-Human HRAS-like suppressor family member 5 (HRASLS5) transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRASLS5; HRLP5; HRSL5; iNAT; PLAAT-5; RLP1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146729, the custom clone sequence may differ by one or more nucleotides
ATGGGCCTGAGCCCGGGCGCCGAGGGGGAGTACGCGCTCCGCCTCCCTAGGATTCCCCCA CCCCTCCCCAAACCCGCCTCGCGAACCGCCGGTACCGGGCCCAAGGACCAGCCGCCTGCG CTCAGACGTTCAGCTGTGCCCCACTCAGAAGAATCCGTGGGATTCGCAGCGTTGGTCCAG CTCCCAGCCAAGCAGCCTCCGCCGGGCACATTAGAACAGGGCAGAAGCATCCAGCAAGGG GAGAAGGCTGTAGTTAGCTTGGAGACCACACCCAGCCAGAAAGCAGACTGGAGTTCAATT CCAAAGCCTGAGAATGAAGGCAAGTTAATAAAGCAAGCAGCTGAGGGAAAACCAAGACCC AGACCTGGAGACCTGATTGAGATTTTTCGAATTGGCTATGAGCACTGGGCCATCTATGTA GAAGATGATTGCGTGGTCCATCTGGCTCCCCCAAGTGAGGAGTTTGAGGTGGGCAGCATT ACTTCCATCTTTAGCAATCGGGCCGTGGTGAAATACAGTCGTCTGGAGGATGTGCTGCAT GGCTGCTCCTGGAAGGTCAATAACAAGCTAGATGGGACGTACCTGCCCTTGCCGGTGGAC AAGATCATCCAGCGTACAAAAAAGATGGTCAACAAGATCGTGCAGTACAGCCTGATTGAA GGGAACTGTGAGCACTTTGTCAATGGCCTCAGATATGGCGTACCCCGGAGCCAGCAGGTA GAGCACGCCCTGATGGAAGGAGCGAAGGCTGCTGGAGCAGTTATTTCAGCTGTAGTGGAT AGCATAAAGCCCAAACCAATAACTGCC |
Restriction Sites | Please inquire |
ACCN | NM_001146729 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146729.1, NP_001140201.1 |
RefSeq Size | 3097 bp |
RefSeq ORF | 810 bp |
Locus ID | 117245 |
Gene Summary | Exhibits both phospholipase A1/2 and acyltransferase activities (PubMed:22825852, PubMed:26503625). Shows phospholipase A1 (PLA1) and A2 (PLA2) activity, catalyzing the calcium-independent release of fatty acids from the sn-1 or sn-2 position of glycerophospholipids (PubMed:22825852). Shows N-acyltransferase activity, catalyzing the calcium-independent transfer of a fatty acyl group at the sn-1 position of phosphatidylcholine (PC) and other glycerophospholipids to the primary amine of phosphatidylethanolamine (PE), forming N-acylphosphatidylethanolamine (NAPE), which serves as precursor for N-acylethanolamines (NAEs) (PubMed:19000777, PubMed:22825852).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 2) compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228791 | HRASLS5 (Myc-DDK-tagged)-Human HRAS-like suppressor family, member 5 (HRASLS5), transcript variant 2 |
CNY 3,990.00 |
|
RC228791L3 | Lenti-ORF clone of HRASLS5 (Myc-DDK-tagged)-Human HRAS-like suppressor family, member 5 (HRASLS5), transcript variant 2 |
CNY 5,890.00 |
|
RC228791L4 | Lenti-ORF clone of HRASLS5 (mGFP-tagged)-Human HRAS-like suppressor family, member 5 (HRASLS5), transcript variant 2 |
CNY 5,890.00 |
|
RG228791 | HRASLS5 (tGFP-tagged) - Human HRAS-like suppressor family, member 5 (HRASLS5), transcript variant 2 |
CNY 4,370.00 |