Secretogranin 3 (SCG3) (NM_001165257) Human Untagged Clone
CAT#: SC327405
SCG3 (untagged)-Human secretogranin III (SCG3) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SGIII |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001165257, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCAATTCAAGATGGTCTTGCTAAGGGAGAAAACGATGAAACAGTATCTAACACA TTAACCTTGACAAATGGCTTGGAAAGGAGAACTAAAACCTACAGTGAAGACAACTTTGAG GAACTCCAATATTTCCCAAATTTCTATGCGCTACTGAAAAGTATTGATTCAGAAAAAGAA GCAAAAGAGAAAGAAACACTGATTACTATCATGAAAACACTGATTGACTTTGTGAAGATG ATGGTGAAATATGGAACAATATCTCCAGAAGAAGGTGTTTCCTACCTTGAAAACTTGGAT GAAATGATTGCTCTTCAGACCAAAAACAAGCTAGAAAAAAATGCTACTGACAATATAAGC AAGCTTTTCCCAGCACCATCAGAGAAGAGTCATGAAGAAACAGACAGTACCAAGGAAGAA GCAGCTAAGATGGAAAAGGAATATGGAAGCTTGAAGGATTCCACAAAAGATGATAACTCC AACCCAGGAGGAAAGACAGATGAACCCAAAGGAAAAACAGAAGCCTATTTGGAAGCCATC AGAAAAAATATTGAATGGTTGAAGAAACATGACAAAAAGGGAAATAAAGAAGATTATGAC CTTTCAAAGATGAGAGACTTCATCAATAAACAAGCTGATGCTTATGTGGAGAAAGGCATC CTTGACAAGGAAGAAGCCGAGGCCATCAAGCGCATTTATAGCAGCCTG |
Restriction Sites | Please inquire |
ACCN | NM_001165257 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001165257.1, NP_001158729.1 |
RefSeq Size | 3313 bp |
RefSeq ORF | 711 bp |
Locus ID | 29106 |
UniProt ID | Q8WXD2 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) lacks the alternate exon containing the translation intiation site compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228770 | SCG3 (Myc-DDK-tagged)-Human secretogranin III (SCG3), transcript variant 2 |
CNY 4,660.00 |
|
RC228770L3 | Lenti-ORF clone of SCG3 (Myc-DDK-tagged)-Human secretogranin III (SCG3), transcript variant 2 |
CNY 6,560.00 |
|
RC228770L4 | Lenti-ORF clone of SCG3 (mGFP-tagged)-Human secretogranin III (SCG3), transcript variant 2 |
CNY 6,560.00 |
|
RG228770 | SCG3 (tGFP-tagged) - Human secretogranin III (SCG3), transcript variant 2 |
CNY 5,130.00 |