ER81 (ETV1) (NM_001163151) Human Untagged Clone

CAT#: SC326969

ETV1 (untagged)-Human ets variant 1 (ETV1) transcript variant 6



  "NM_001163151" in other vectors (4)

CNY 6,750.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ETV1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ER81
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326969 representing NM_001163151.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTCAAGATTTAAGTGCAAGTGTCTTCTTTCCACCTTGTTCACAACACAGAACGTTAGTGGCTTTT
CATGGCCTGCCACTGAAAATCAAGAAAGAACCCCACAGTCCATGTTCAGAAATCAGCTCTGCCTGCAGT
CAAGAACAGCCCTTTAAATTCAGCTATGGAGAAAAGTGCCTGTACAATGTCAGTGCCTATGATCAGAAG
CCACAAGTGGGAATGAGGCCCTCCAACCCCCCCACACCATCCAGCACGCCAGTGTCCCCACTGCATCAT
GCATCTCCAAACTCAACTCATACACCGAAACCTGACCGGGCCTTCCCAGCTCACCTCCCTCCATCGCAG
TCCATACCAGATAGCAGCTACCCCATGGACCACAGATTTCGCCGCCAGCTTTCTGAACCCTGTAACTCC
TTTCCTCCTTTGCCGACGATGCCAAGGGAAGGACGTCCTATGTACCAACGCCAGATGTCTGAGCCAAAC
ATCCCCTTCCCACCACAAGGCTTTAAGCAGGAGTACCACGACCCAGTGTATGAACACAACACCATGGTT
GGCAGTGCGGCCAGCCAAAGCTTTCCCCCTCCTCTGATGATTAAACAGGAACCCAGAGATTTTGCATAT
GACTCAGAAGTGCCTAGCTGCCACTCCATTTATATGAGGCAAGAAGGCTTCCTGGCTCATCCCAGCAGA
ACAGAAGGCTGTATGTTTGAAAAGGGCCCCAGGCAGTTTTATGATGACACCTGTGTTGTCCCAGAAAAA
TTCGATGGAGACATCAAACAAGAGCCAGGAATGTATCGGGAAGGACCCACATACCAACGGCGAGGATCA
CTTCAGCTCTGGCAGTTTTTGGTAGCTCTTCTGGATGACCCTTCAAATTCTCATTTTATTGCCTGGACT
GGTCGAGGCATGGAATTTAAACTGATTGAGCCTGAAGAGGTGGCCCGACGTTGGGGCATTCAGAAAAAC
AGGCCAGCTATGAACTATGATAAACTTAGCCGTTCACTCCGCTATTACTATGAGAAAGGAATTATGCAA
AAGGTGGCTGGAGAGAGATATGTCTACAAGTTTGTGTGTGATCCAGAAGCCCTTTTCTCCATGGCCTTT
CCAGATAATCAGCGTCCACTGCTGAAGACAGACATGGAACGTCACATCAACGAGGAGGACACAGTGCCT
CTTTCTCACTTTGATGAGAGCATGGCCTACATGCCGGAAGGGGGCTGCTGCAACCCCCACCCCTACAAC
GAAGGCTACGTGTATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001163151
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001163151.1
RefSeq Size 6249 bp
RefSeq ORF 1260 bp
Locus ID 2115
UniProt ID P50549
Protein Families ES Cell Differentiation/IPS, Transcription Factors
MW 48.2 kDa
Gene Summary This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (6) represents use of an alternate promoter, 5' UTR, 5' coding region, and lacks an alternate in-frame exon, compared to variant 1. The resulting isoform (e) has a shorter and distinct N-terminus, compared to isoform a. This isoform lacks the N-terminal TAD. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...