POU5F1B (NM_001159542) Human Untagged Clone

CAT#: SC326923

POU5F1B (untagged)-Human POU class 5 homeobox 1B (POU5F1B)



  "NM_001159542" in other vectors (4)

CNY 3,656.00

CNY 5,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal P5F1B Antibody (C-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OCT4-PG1; OCT4PG1; OTF3C; OTF3P1; POU5F1P1; POU5F1P4; POU5FLC8; POU5FLC20
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001159542 edited
ATGGCGGGACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGCGGTGGGGGTGAT
GGGCCATGGGGGGCGGAGCCGGGCTGGGTTGATCCTCTGACCTGGCTAAGCTTCCAAGGC
CCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATT
CCCCCTTGCCCCCCGCCGTATGAGTTATGTGGGGGGATGGCGTACTGTGGGCCTCAGGTT
GGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGAGCGAAGCAGGA
GTCGGGGTGGAGAGCAACTCCAATGGGGCCTCCCCGGAACCCTGCACCGTCCCCCCTGGT
GCCGTGAAGCTGGAGAAGGAGAAGCTAGAGCAAAACCCGGAGAAGTCCCAGGACATCAAA
GCTCTGCAGAAAGAACTCGAGCAATTTGCCAAGCTCCTGAAGCAGAAGAGGATCACCCTG
GGATATACACAGGCCGATGTGGGGCTCATCCTGGGGGTTCTATTTGGGAAGGTGTTCAGC
CAAAAGACCATCTGCCGCTTTGAGGCTCTGCAGCTTAGCTTCAAGAACATGTGTAAGCTG
CGGCCCTTGCTGCAGAAGTGGGTGGAGGAAGCTGACAACAATGAAAATCTTCAGGAGATA
TGCAAAGCAGAAACCCTCATGCAGGCCCGAAAGAGAAAGCGAACCAGTATCGAGAACCGA
GTGAGAGGCAACCTGGAGAATTTGTTCCTGCAGTGCCCGAAACCCACACTGCAGATCAGC
CACATCGCCCAGCAGCTTGGGCTCGAGAAGGATGTGGTCCGAGTGTGGTTCTGTAACCGG
CGCCAGAAGGGCAAGCGATCAAGCAGCGACTATGCACAACGAGAGGATTTTGAGGCTGCT
GGGTCTCCTTTCTCAGGGGGACCAGTGTCCTTTCCTCCGGCCCCAGGGCCCCATTTTGGT
ACCCCAGGCTATGGGAGCCCTCACTTCACTGCACTGTACTCCTCAGTCCCTTTCCCTGAG
GGGGAAGTCTTTCCCCCAGTCTCCGTCATCACTCTGGGCTCTCCCATGCATTCAAACTGA
Restriction Sites Please inquire     
ACCN NM_001159542
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001159542.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001159542.1, NP_001153014.1
RefSeq Size 1599 bp
RefSeq ORF 1080 bp
Locus ID 5462
UniProt ID Q06416
Gene Summary This intronless gene was thought to be a transcribed pseudogene of POU class 5 homeobox 1, however, it has been reported that this gene can encode a functional protein. The encoded protein is nearly the same length as and highly similar to the POU class 5 homeobox 1 transcription factor, has been shown to be a weak transcriptional activator and may play a role in carcinogenesis and eye development. [provided by RefSeq, Apr 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...