BCAT2 (NM_001164773) Human Untagged Clone

CAT#: SC326869

BCAT2 (untagged)-Human branched chain aminotransferase 2 mitochondrial (BCAT2) transcript variant b



  "NM_001164773" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
BCAT2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCAM; BCATM; BCT2; HVLI; PP18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326869 representing NM_001164773.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGCAGCCGCTCTGGGGCAGCTGTTTGAGGGCATGAAGGCGTTCAAAGGCAAAGACCAGCAGGTG
CGCCTCTTCCGCCCCTGGCTCAACATGGACCGGATGCTGCGCTCAGCCATGCGCCTGTGCCTGCCGAGT
TTCGACAAGCTGGAGTTGCTGGAGTGCATCCGCCGGCTCATCGAAGTGGACAAGGACTGGGTCCCCGAT
GCCGCCGGCACCAGCCTCTATGTGCGGCCTGTGCTCATTGGGAACGAGCCCTCGCTGGGTGTCAGCCAG
CCCACGCGCGCGCTCCTGTTCGTCATTCTCTGCCCAGTGGGTGCCTACTTCCCTGGAGGCTCCGTGACC
CCGGTCTCCCTCCTGGCCGACCCAGCCTTCATCCGGGCCTGGGTGGGCGGGGTCGGCAACTACAAGTTA
GGTGGGAATTATGGGCCCACCGTGTTAGTGCAACAGGAGGCACTCAAGCGGGGCTGTGAACAGGTCCTC
TGGCTGTATGGGCCCGACCACCAGCTCACCGAGGTGGGAACCATGAACATCTTTGTCTACTGGACCCAC
GAAGATGGGGTGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTGGTCAGACAG
AGTCTACTGGACATGGCTCAGACCTGGGGTGAGTTCCGGGTGGTGGAGCGCACGATCACCATGAAGCAG
TTGCTGCGGGCCCTGGAGGAGGGCCGCGTGCGGGAAGTCTTTGGCTCGGGCACCGCTTGCCAGGTCTGC
CCAGTGCACCGAATCCTGTACAAAGACAGGAACCTCCACATTCCCACCATGGAAAATGGGCCTGAGCTG
ATCCTCCGCTTCCAGAAGGAGCTGAAGGAGATCCAGTACGGAATCAGAGCCCACGAGTGGATGTTCCCG
GTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164773
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164773.1
RefSeq Size 1340 bp
RefSeq ORF 903 bp
Locus ID 587
UniProt ID O15382
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis, Valine, leucine and isoleucine biosynthesis, Valine, leucine and isoleucine degradation
MW 33.8 kDa
Gene Summary This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (b) lacks two alternate in-frame exons in the 5' coding region, compared to variant a. The resulting isoform (b), also known as PP18b, lacks an internal segment near the N-terminus, compared to isoform a, which disrupts the transit peptide. This isoform is found in the cytosol.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...