RAD51 (NM_001164270) Human Untagged Clone

CAT#: SC326847

RAD51 (untagged)-Human RAD51 homolog (RecA homolog E. coli) (S. cerevisiae) (RAD51) transcript variant 3



  "NM_001164270" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RAD51 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRCC5; FANCR; HRAD51; HsRad51; HsT16930; MRMV2; RAD51A; RECA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326847 representing NM_001164270.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTTGGCCCACAA
CCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAATTGGAAGAAGCTGGATTC
CATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTAATAAATATTAAGGGAATTAGTGAAGCC
AAAGCTGATAAAATTCTGGCTGAGGCAGCTAAATTAGTTCCAATGGGTTTCACCACTGCAACTGAATTC
CACCAAAGGCGGTCAGAGATCATACAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGT
GGAATTGAGACTGGATCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCAT
ACGCTAGCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATTGAC
ACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTCTCTGGCAGTGAT
GTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAGACCCAGCTCCTTTATCAAGCA
TCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATTGTAGACAGTGCCACCGCCCTTTACAGAACA
GACTACTCGGGTCGAGGTGAGCTTTCAGCCAGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTG
CGACTCGCTGATGAGATTGTATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTC
TCCCTGTCTTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164270
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164270.1
RefSeq Size 2177 bp
RefSeq ORF 843 bp
Locus ID 5888
UniProt ID Q06609
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Protein Pathways Homologous recombination, Pancreatic cancer, Pathways in cancer
MW 31 kDa
Gene Summary The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Transcript Variant: This variant (3) uses an alternate exon in the 5' coding region and lacks an alternate exon in the 3' coding region resulting in a frameshift, compared to variant 2. The resulting isoform (3) contains a distinct segment near the N-terminus and has a shorter and distinct C-terminus, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...