RNF170 (NM_001160223) Human Untagged Clone

CAT#: SC326830

RNF170 (untagged)-Human ring finger protein 170 (RNF170) transcript variant 1



  "NM_001160223" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RNF170 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADSA; SNAX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326830 representing NM_001160223.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAAATATCAAGGTGAAGTTCAAAGTTTGAAACTGGATGATGATTCAGTTATAGAAGGAGTAAGC
GACCAAGTACTTGTGGCAGTTGTGGTCAGTTTCGCTTTGATTGCTACCCTGGTATATGCACTTTTCAGA
AATGTACATCAAAACATTCACCCAGAAAACCAGGAGCTAGTAAGGGTACTTCGAGAACAGCTTCAAACA
GAACAGGATGCACCTGCTGCCACTCGACAGCAGTTCTACACTGACATGTACTGTCCCATCTGCCTGCAC
CAAGCCTCCTTCCCGGTGGAGACCAACTGTGGACATCTTTTTTGTGGTGCCTGCATTATTGCTTACTGG
CGATATGGTTCATGGCTTGGGGCAATCAGTTGTCCAATCTGTAGACAAACGGTAACCTTACTCCTAACA
GTATTTGGTGAAGATGATCAGTCTCAGGATGTTCTGAGATTGCATCAGGATATTAATGATTATAACCGG
AGATTCTCAGGGCAACCCAGATCTATTATGGAGAGAATTATGGATCTACCCACTTTACTGAGGCATGCA
TTCAGGGAAATGTTTTCAGTCGGGGGCCTTTTCTGGATGTTTCGCATCAGGATAATACTTTGTTTAATG
GGAGCTTTTTTCTATCTTATATCACCTCTAGATTTTGTACCTGAAGCCTTGTTTGGAATTCTAGGCTTT
CTAGATGATTTCTTTGTCATCTTTTTATTGCTTATCTACATCTCTATTATGTATCGAGAAGTGATAACC
CAAAGGCTAACTAGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001160223
Insert Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001160223.1
RefSeq Size 4136 bp
RefSeq ORF 777 bp
Locus ID 81790
UniProt ID Q96K19
Protein Families Druggable Genome, Transmembrane
MW 29.8 kDa
Gene Summary This gene encodes a RING domain-containing protein that resides in the endoplasmic reticulum (ER) membrane. This protein functions as an E3 ubiquitin ligase and mediates ubiquitination and processing of inositol 1,4,5-trisphosphate (IP3) receptors via the ER-associated protein degradation pathway. It is recruited to the activated IP3 receptors by the ERLIN1/ERLIN2 complex to which it is constitutively bound. Mutations in this gene are associated with autosomal dominant sensory ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...