RNF170 (NM_001160223) Human Untagged Clone
CAT#: SC326830
RNF170 (untagged)-Human ring finger protein 170 (RNF170) transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADSA; SNAX1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326830 representing NM_001160223.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCAAATATCAAGGTGAAGTTCAAAGTTTGAAACTGGATGATGATTCAGTTATAGAAGGAGTAAGC GACCAAGTACTTGTGGCAGTTGTGGTCAGTTTCGCTTTGATTGCTACCCTGGTATATGCACTTTTCAGA AATGTACATCAAAACATTCACCCAGAAAACCAGGAGCTAGTAAGGGTACTTCGAGAACAGCTTCAAACA GAACAGGATGCACCTGCTGCCACTCGACAGCAGTTCTACACTGACATGTACTGTCCCATCTGCCTGCAC CAAGCCTCCTTCCCGGTGGAGACCAACTGTGGACATCTTTTTTGTGGTGCCTGCATTATTGCTTACTGG CGATATGGTTCATGGCTTGGGGCAATCAGTTGTCCAATCTGTAGACAAACGGTAACCTTACTCCTAACA GTATTTGGTGAAGATGATCAGTCTCAGGATGTTCTGAGATTGCATCAGGATATTAATGATTATAACCGG AGATTCTCAGGGCAACCCAGATCTATTATGGAGAGAATTATGGATCTACCCACTTTACTGAGGCATGCA TTCAGGGAAATGTTTTCAGTCGGGGGCCTTTTCTGGATGTTTCGCATCAGGATAATACTTTGTTTAATG GGAGCTTTTTTCTATCTTATATCACCTCTAGATTTTGTACCTGAAGCCTTGTTTGGAATTCTAGGCTTT CTAGATGATTTCTTTGTCATCTTTTTATTGCTTATCTACATCTCTATTATGTATCGAGAAGTGATAACC CAAAGGCTAACTAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001160223 |
Insert Size | 777 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001160223.1 |
RefSeq Size | 4136 bp |
RefSeq ORF | 777 bp |
Locus ID | 81790 |
UniProt ID | Q96K19 |
Protein Families | Druggable Genome, Transmembrane |
MW | 29.8 kDa |
Gene Summary | This gene encodes a RING domain-containing protein that resides in the endoplasmic reticulum (ER) membrane. This protein functions as an E3 ubiquitin ligase and mediates ubiquitination and processing of inositol 1,4,5-trisphosphate (IP3) receptors via the ER-associated protein degradation pathway. It is recruited to the activated IP3 receptors by the ERLIN1/ERLIN2 complex to which it is constitutively bound. Mutations in this gene are associated with autosomal dominant sensory ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228195 | RNF170 (Myc-DDK-tagged)-Human ring finger protein 170 (RNF170), transcript variant 1 |
CNY 2,400.00 |
|
RC228195L1 | Lenti ORF clone of Human ring finger protein 170 (RNF170), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC228195L2 | Lenti ORF clone of Human ring finger protein 170 (RNF170), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC228195L3 | Lenti ORF clone of Human ring finger protein 170 (RNF170), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228195L4 | Lenti ORF clone of Human ring finger protein 170 (RNF170), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG228195 | RNF170 (tGFP-tagged) - Human ring finger protein 170 (RNF170), transcript variant 1 |
CNY 4,370.00 |