United States
Germany
Japan
United Kingdom
China
KLF8 (NM_001159296) Human Untagged Clone
CAT＃: SC326829
KLF8 (untagged)-Human Kruppel-like factor 8 (KLF8) transcript variant 2
CNY 3,990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BKLF3; ZNF741 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326829 representing NM_001159296.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCGATATGGATAAACTCATAAACAACTTGGAGGTCCAACTTAATTCAGAAGGTGGCTCAATGCAG GTATTCAAGCAGGTCACTGCTTCTGTTCGGAACAGAGATCCCCCTGAGATAGAATACAGAAGTAATATG ACTTCTCCAACACTCCTGGATGCCAACCCCATGGAGAACCCAGCACTGTTTAATGACATCAAGATTGAG CCCCCAGAAGAACTTTTGGCTAGTGATTTCAGCCTGCCCCAAGTGGAACCAGTTGACCTCTCCTTTCAC AAGCCCAAGGCTCCTCTCCAGCCTGCTAGCATGCTACAAGCTCCAATACGTCCCCCCAAGCCACAGTCT TCTCCCCAGACCCTTGTGGTGTCCACGTCAACATCTGACATGAGCACTTCAGCAAACATTCCTACTGTT CTGACCCCAGGCTCTGTCCTGACCTCCTCTCAGAGCACTGGTAGCCAGCAGATCTTACATGTCATTCAC ACTATCCCCTCAGTCAGTCTGCCAAATAAGATGGGTGGCCTGAAGACCATCCCAGTGGTAGTGCAGTCT CTGCCCATGGTGTATACTACTTTGCCTGCAGATGGGGGCCCTGCAGCCATTACAGTCCCACTCATTGGA GGAGATGGTAAAAATGCTGGATCAGTGAAAGTTGACCCCACCTCCATGTCTCCACTGGAAATTCCAAGT GACAGTGAGGAGAGTACAATTGAGAGTGGATCCTCAGCCTTGCAGAGTCTGCAGGGACTACAGCAAGAG AGAGAAGCCTTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001159296 |
| Insert Size | 774 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001159296.2 |
| RefSeq Size | 8544 bp |
| RefSeq ORF | 774 bp |
| Locus ID | 11279 |
| UniProt ID | O95600 |
| Protein Families | Transcription Factors |
| MW | 27.2 kDa |
| Gene Summary | This gene encodes a protein which is a member of the Sp/KLF family of transcription factors. Members of this family contain a C-terminal DNA-binding domain with three Kruppel-like zinc fingers. The encoded protein is thought to play an important role in the regulation of epithelial to mesenchymal transition, a process which occurs normally during development but also during metastasis. A pseudogene has been identified on chromosome 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (2) differs in the 5' UTR and lacks an exon in the 3' coding region that causes a frameshift compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228194 | KLF8 (Myc-DDK-tagged)-Human Kruppel-like factor 8 (KLF8), transcript variant 2 |
CNY 3,600.00 |
|
| RC228194L1 | Lenti-ORF clone of KLF8 (Myc-DDK-tagged)-Human Kruppel-like factor 8 (KLF8), transcript variant 2 |
CNY 6,000.00 |
|
| RC228194L2 | Lenti-ORF clone of KLF8 (mGFP-tagged)-Human Kruppel-like factor 8 (KLF8), transcript variant 2 |
CNY 5,890.00 |
|
| RC228194L3 | Lenti-ORF clone of KLF8 (Myc-DDK-tagged)-Human Kruppel-like factor 8 (KLF8), transcript variant 2 |
CNY 5,890.00 |
|
| RC228194L4 | Lenti-ORF clone of KLF8 (mGFP-tagged)-Human Kruppel-like factor 8 (KLF8), transcript variant 2 |
CNY 5,890.00 |
|
| RG228194 | KLF8 (tGFP-tagged) - Human Kruppel-like factor 8 (KLF8), transcript variant 2 |
CNY 4,370.00 |
