United States
Germany
Japan
United Kingdom
China
DOK7 (NM_001164673) Human Untagged Clone
CAT＃: SC326826
DOK7 (untagged)-Human docking protein 7 (DOK7) transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C4orf25; CMS1B; CMS10; FADS3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001164673, the custom clone sequence may differ by one or more nucleotides
ATGACCGAGGCGGCGCTGGTGGAGGGCCAGGTCAAGCTGCGGGACGGCAAGAAGTGGAAG AGTAGGTGGCTGGTGCTGCGGAAGCCGTCGCCCGTGGCAGACTGCCTGCTGATGCTGGTC TACAAGGACAAGTCGGAGCGTATCAAGGGCCTGCGGGAGCGCAGCAGCCTGACGCTAGAG GACATCTGCGGGCTGGAGCCCGGCCTGCCCTACGAGGGCCTGGTCCACACGCTGGCCATT GTCTGCCTGTCCCAGGCCATCATGCTGGGCTTTGACAGCCACGAGGCCATGTGTGCGTGG GATGCCCGGATCCGCTATGCGCTCGGCGAGGTGCATAGGTTCCATGTGACAGTGGCTCCA GGCACCAAGTTGGAGAGCGGCCCGGCTACCCTGCACCTCTGCAATGATGTCCTCGTCTTG GCCAGGGACATCCCCCCGGCTGTCACGGGGCAGTGGAAGCTGTCTGACCTCCGGCGCTAC GGGGCCGTGCCAAGCGGATTCATCTTTGAAGGCGGGACCAGGGGCTGGCGTCTTCTTCCT GTCCTCGGCCGAGGGGGAGCAGATCAGCTTCCTGTTCGACTGCATCGTCCGAGGCATCTC CCCCACCAAGGGCCCCTTTGGGCTGCGGCCGGTTCTACCAGACCCAAGTCCCCCGGGACC CTCGACTGTGGAGGAGCGTGTGGCCCAGGAAGCCCTGGAAACCCTACAGCTGGAGAAGCG GCTGAGCCTCCTCTCACATGCGGGCAGGCCGGGCAGTGGAGGGGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001164673 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001164673.1, NP_001158145.1 |
| RefSeq Size | 2572 bp |
| RefSeq ORF | 768 bp |
| Locus ID | 285489 |
| UniProt ID | Q18PE1 |
| Gene Summary | The protein encoded by this gene is essential for neuromuscular synaptogenesis. The protein functions in aneural activation of muscle-specific receptor kinase, which is required for postsynaptic differentiation, and in the subsequent clustering of the acetylcholine receptor in myotubes. This protein can also induce autophosphorylation of muscle-specific receptor kinase. Mutations in this gene are a cause of familial limb-girdle myasthenia autosomal recessive, which is also known as congenital myasthenic syndrome type 1B. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence and uses an alternate splice site in the central coding region compared to variant 4, that causes a frameshift. The encoded isoform (2) differs in the central region and has a shorter and distinct C-terminus compared to isoform 4. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228191 | DOK7 (Myc-DDK-tagged)-Human docking protein 7 (DOK7), transcript variant 2 |
CNY 3,990.00 |
|
| RC228191L3 | Lenti-ORF clone of DOK7 (Myc-DDK-tagged)-Human docking protein 7 (DOK7), transcript variant 2 |
CNY 5,890.00 |
|
| RC228191L4 | Lenti-ORF clone of DOK7 (mGFP-tagged)-Human docking protein 7 (DOK7), transcript variant 2 |
CNY 5,890.00 |
|
| RG228191 | DOK7 (tGFP-tagged) - Human docking protein 7 (DOK7), transcript variant 2 |
CNY 4,370.00 |
