SVH (ARMC10) (NM_001161012) Human Untagged Clone
CAT#: SC326816
ARMC10 (untagged)-Human armadillo repeat containing 10 (ARMC10) transcript variant D
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PNAS-112; PNAS112; PSEC0198; SVH |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161012, the custom clone sequence may differ by one or more nucleotides
ATGGGTGGCCCCCGGGGCGCGGGCTGGGTGGCGGCGGGCCTGCTGCTCGGCGCGGGCGCC TGCTACTGCATTTACAGGCTGACCCGGGGTCGGCGGCGGGGCGACCGCGAGCTCGGGATA CGCTCTTCGAAGTCCGCAGAAGACTTAACTGATGGTTCATATGATGATGTTCTAAATGCT GAACAACTTCAGAAACTCCTTTACCTGCTGGAGTCAACGGAGGATCCTGTAATTATTGAA AGAGCTTTGATTACTTTGGGTAACAATGCAGCCTTTTCAGTTAACCAAGCTATTATTCGT GAATTGGGTGGTATTCCAATTGTTGCAAACAAAATCAACCATTCCAACCAGAGTATTAAA GAGAAAGCTTTAAATGCACTAAATAACCTGAGTGTGAATGTTGAAAATCAAATCAAGATA AAGGTGCAAGTTTTGAAACTGCTTTTGAATTTGTCTGAAAATCCAGCCATGACAGAAGGA CTTCTCCGTGCCCAAGTGGATTCATCATTCCTTTCCCTTTATGACAGCCACGTAGCAAAG GAGATTCTTCTTCGAGTACTTACGCTATTTCAGAATATAAAGAACTGCCTCAAAATAGAA GGCCATTTAGCTGTGCAGCCTACTTTCACTGAAGGTTCATTGTTTTTCCTGTTACATGGA GAAGAATGTGCCCAGAAAATAAGAGCTTTAGTTGATCACCATGATGCAGAGGTGAAGGAA AAGGTTGTAACAATAATACCCAAAATC |
Restriction Sites | Please inquire |
ACCN | NM_001161012 |
Insert Size | 2369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001161012.1, NP_001154484.1 |
RefSeq Size | 2369 bp |
RefSeq ORF | 750 bp |
Locus ID | 83787 |
UniProt ID | Q8N2F6 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (D) lacks two in-frame exons in the coding region compared to variant A. This results in a shorter protein (isoform d) compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228181 | ARMC10 (Myc-DDK-tagged)-Human armadillo repeat containing 10 (ARMC10), transcript variant D |
CNY 3,990.00 |
|
RC228181L3 | Lenti-ORF clone of ARMC10 (Myc-DDK-tagged)-Human armadillo repeat containing 10 (ARMC10), transcript variant D |
CNY 5,890.00 |
|
RC228181L4 | Lenti-ORF clone of ARMC10 (mGFP-tagged)-Human armadillo repeat containing 10 (ARMC10), transcript variant D |
CNY 5,890.00 |
|
RG228181 | ARMC10 (tGFP-tagged) - Human armadillo repeat containing 10 (ARMC10), transcript variant D |
CNY 4,370.00 |