Endonuclease V (ENDOV) (NM_001164637) Human Untagged Clone
CAT#: SC326803
ENDOV (untagged)-Human hypothetical protein FLJ35220 (FLJ35220) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326803 representing NM_001164637.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCTGGAGGCGGCGGGAGGGCCGCCGGAGGAAACGCTGTCACTGTGGAAACGGGAGCAAGCTCGG CTGAAGGCCCACGTCGTAGACCGGGACACCGAGGCGTGGCAGCGAGACCCCGCCTTCTCGGGTCTGCAG AGGGTCGGGGGCGTTGACGTGTCCTTCGTGAAAGGGGACAGTGTCCGCGCTTGTGCTTCCCTGGTGGTG CTCAGCTTCCCTGAGCTCGAGGTCCTTCTTGTGGATGGAAACGGGGTACTCCACCACCGAGGCTTTGGG GTGGCCTGCCACCTTGGCGTCCTTACAGACCTGCCGTGTGTTGGGGTGGCCAAGAAACTTCTGCAGGTG GATGGGCTGGAGAACAACGCCCTGCACAAGGAGAAGATCCGACTCCTGCAGACTCGAGGAGACTCATTC CCTCTGCTGGGAGACTCTGGGACTGTCCTGGGAATGGCCCTGAGGAGCCACGACCGCAGCACCAGGCCC CTCTACATCTCCGTGGGCCACAGGATGAGCCTGGAGGCCGCTGTGCGCCTGACTTGCTGCTGCTGCAGG TTCCGGATCCCAGAGCCCGTGCGCCAGGCTGACATCTGCTCCCGAGAGCACATCCGCAAGTCGCTGGGA CTCCCCGGGCCACCCACACCGAGGAGCCCGAAGGCGCAGAGGCCAGTGGCATGCCCCAAAGGAGACTCC GGAGAGTCCTCAGCACTTTGTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164637 |
Insert Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164637.2 |
RefSeq Size | 2705 bp |
RefSeq ORF | 714 bp |
Locus ID | 284131 |
UniProt ID | Q8N8Q3 |
Protein Families | Druggable Genome |
MW | 25.6 kDa |
Gene Summary | Endoribonuclease that specifically cleaves inosine-containing RNAs: cleaves RNA at the second phosphodiester bond 3' to inosine. Has strong preference for single-stranded RNAs (ssRNAs) toward double-stranded RNAs (dsRNAs). Cleaves mRNAs and tRNAs containing inosine. Also able to cleave structure-specific dsRNA substrates containing the specific sites 5'-IIUI-3' and 5'-UIUU-3'. Inosine is present in a number of RNAs following editing; the function of inosine-specific endoribonuclease is still unclear: it could either play a regulatory role in edited RNAs, or be involved in antiviral response by removing the hyperedited long viral dsRNA genome that has undergone A-to-I editing. Binds branched DNA structures.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (2) lacks and internal segment, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228168 | ENDOV (Myc-DDK-tagged)-Human endonuclease V (ENDOV), transcript variant 2 |
CNY 2,400.00 |
|
RC228168L3 | Lenti ORF clone of Human endonuclease V (ENDOV), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228168L4 | Lenti ORF clone of Human endonuclease V (ENDOV), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG228168 | ENDOV (tGFP-tagged) - Human endonuclease V (ENDOV), transcript variant 2 |
CNY 4,370.00 |
其它Endonuclease V产品