United States
Germany
Japan
United Kingdom
China
RAB37 (NM_001163989) Human Untagged Clone
CAT＃: SC326796
RAB37 (untagged)-Human RAB37 member RAS oncogene family (RAB37) transcript variant 4
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001163989, the custom clone sequence may differ by one or more nucleotides
ATGTGGCTCATGTCCGAAGCGCACGGAGCCGAGCCGGTGTTGCTCAGGGAGGCTGCCCGC CCCTTCACGCAGACCCTGCGGCTCTGCGTGCCCTCAGGGAACAGCAAGGTGATGCTTCTG GGAGACACAGGCGTCGGCAAAACATGTTTCCTGATCCAATTCAAAGACGGGGCCTTCCTG TCCGGAACCTTCATAGCCACCGTCGGCATAGACTTCAGGAACAAGGTGGTGACTGTGGAT GGCGTGAGAGTGAAGCTGCAGATCTGGGACACCGCTGGGCAGGAACGGTTCCGAAGCGTC ACCCATGCTTATTACAGAGATGCTCAGGCCTTGCTTCTGCTGTATGACATCACCAACAAA TCTTCTTTCGACAACATCAGGGCCTGGCTCACTGAGATTCATGAGTATGCCCAGAGGGAC GTGGTGATCATGCTGCTAGGCAACAAGGCGGATATGAGCAGCGAAAGAGTGATCCGTTCC GAAGACGGAGAGACCTTGGCCAGGGAGTACGGTGTTCCCTTCCTGGAGACCAGCGCCAAG ACTGGCATGAATGTGGAGTTAGCCTTTCTGGCCATCGCCAAGGAACTGAAATACCGGGCC GGGCATCAGGCGGATGAGCCCAGCTTCCAGATCCGAGACTATGTAGAGTCCCAGAAGAAG CGCTCCAGCTGCTGCTCCTTCATG |
| Restriction Sites | Please inquire |
| ACCN | NM_001163989 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001163989.1, NP_001157461.1 |
| RefSeq Size | 2847 bp |
| RefSeq ORF | 687 bp |
| Locus ID | 326624 |
| UniProt ID | Q96AX2 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508.[supplied by OMIM, Apr 2006] Transcript Variant: This variant (4) represents use of an alternate promoter, 5' UTR, and alternate start codon, and includes an alternate coding exon, compared to variant 3. The resulting isoform (4) has a distinct and longer N-terminus, compared to isoform 3. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228161 | RAB37 (Myc-DDK-tagged)-Human RAB37, member RAS oncogene family (RAB37), transcript variant 4 |
CNY 3,990.00 |
|
| RC228161L3 | Lenti-ORF clone of RAB37 (Myc-DDK-tagged)-Human RAB37, member RAS oncogene family (RAB37), transcript variant 4 |
CNY 5,890.00 |
|
| RC228161L4 | Lenti-ORF clone of RAB37 (mGFP-tagged)-Human RAB37, member RAS oncogene family (RAB37), transcript variant 4 |
CNY 5,890.00 |
|
| RG228161 | RAB37 (tGFP-tagged) - Human RAB37, member RAS oncogene family (RAB37), transcript variant 4 |
CNY 5,440.00 |
