MS4A12 (NM_001164470) Human Untagged Clone

CAT#: SC326786

MS4A12 (untagged)-Human membrane-spanning 4-domains subfamily A member 12 (MS4A12) transcript variant 2



  "NM_001164470" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MS4A12 mouse monoclonal antibody,clone OTI5F5
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Ms4a10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326786 representing NM_001164470.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGTCATCCAAGCCAACAAGCCATGCTGAAGTAAATGAAACCATACCCAACCCTTACCCACCAAGC
AGCTTTATGGCTCCTGGATTTCAACAGCCTCTGGGTTCAATCAACTTAGAAAACCAAGCTCAGGGTGCT
CAGCGTGCTCAGCCCTACGGCATCACATCTCCGGGAATCTTTGCTAGCAGTCAACCGGGTCAAGGAAAT
ATACAAATGATAAATCCAAGTGTGGGAACAGCAGTAATGAACTTTAAAGAAGAAGCAAAGGCACTAGGG
TTTATTATCTCTGGCTCTCTCTCTGTGTCAGCATCCAAGGAGCTTTCCCGTTGTCTGGTGAAAGGCAGC
CTGGGAATGAACATTGTTAGTTCTATCTTGGCCTTCATTGGAGTGATTCTGCTGCTGGTGGATATGTGC
ATCAATGGGGTAGCTGGCCAAGACTACTGGGCCGTGCTTTCTGGAAAAGGCATTTCAGCCACGCTGATG
ATCTTCTCCCTCTTGGAGTTCTTCGTAGCTTGTGCCACAGCCCATTTTGCCAACCAAGCAAACACCACA
ACCAATATGTCTGTCCTGGTTATTCCAAATATGTATGAAAGCAACCCTGTGACACCAGCGTCTTCTTCA
GCTCCTCCCAGATGCAACAACTACTCAGCTAATGCCCCTAAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164470
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164470.1
RefSeq Size 1044 bp
RefSeq ORF 666 bp
Locus ID 54860
UniProt ID Q9NXJ0
Protein Families Druggable Genome, Transmembrane
MW 23.2 kDa
Gene Summary The protein encoded by this gene is a cell surface protein found primarily in the apical membrane of colonocytes. Silencing of this gene in colon cancer cells inhibits the proliferation, cell motility, and chemotactic invasion of cells. This gene is part of a cluster of similar genes found on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...