Guanylate kinase (GUK1) (NM_001159390) Human Untagged Clone
CAT#: SC326784
GUK1 (untagged)-Human guanylate kinase 1 (GUK1) transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GMK |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001159390, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGAC GGCATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCC |
Restriction Sites | Please inquire |
ACCN | NM_001159390 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001159390.1, NP_001152862.1 |
RefSeq Size | 990 bp |
RefSeq ORF | 657 bp |
Locus ID | 2987 |
UniProt ID | Q16774 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Purine metabolism |
Gene Summary | The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (1) contains an alternate coding exon in the 3' end compared to variant 5, that causes a frameshift. The resulting isoform (a) has a shorter and distinct C-terminus compared to isoform c. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228149 | GUK1 (Myc-DDK-tagged)-Human guanylate kinase 1 (GUK1), transcript variant 1 |
CNY 2,640.00 |
|
RC228149L3 | Lenti-ORF clone of GUK1 (Myc-DDK-tagged)-Human guanylate kinase 1 (GUK1), transcript variant 1 |
CNY 5,890.00 |
|
RC228149L4 | Lenti-ORF clone of GUK1 (mGFP-tagged)-Human guanylate kinase 1 (GUK1), transcript variant 1 |
CNY 5,890.00 |
|
RG228149 | GUK1 (tGFP-tagged) - Human guanylate kinase 1 (GUK1), transcript variant 1 |
CNY 4,240.00 |
其它Guanylate kinase产品