DISC1 (NM_001164556) Human Untagged Clone

CAT#: SC326768

DISC1 (untagged)-Human disrupted in schizophrenia 1 (DISC1) transcript variant t



  "NM_001164556" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-DISC1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf136; SCZD9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164556, the custom clone sequence may differ by one or more nucleotides
ATGCCAGGCGGGGGTCCTCAGGGCGCCCCAGCCGCCGCCGGCGGCGGCGGCGTGAGCCAC
CGCGCAGCTGAGACGTTACAACAAAGATTAGAAGACCTGGAACAAGAGAAAATCAGCCTG
CACTTTCAACTTCCTTCAAGGCAGCCAGCTCTTAGCAGTTTCCTGGGTCACCTGGCAGCA
CAAGTCCAGGCTGCCTTGCGCCGTGGGGCCACTCAGCAGGCCAGCGGAGATGACACCCAC
ACCCCACTGAGAATGGAGCCGAGGCTGTTGGAACCCACTGCTCAGGACAGCTTGCACGTG
TCCATCACGAGACGAGACTGGCTTCTTCAGGAAAAGCAGCAGCTACAGAAAGAAATCGAA
GCTCTCCAAGCAAGGATGTTTGTGCTGGAAGCCAAAGATCAACAGCTGAGAAGGGAAATA
GAGGAGCAAGAGCAGCAACTCCAGTGGCAGGGCTGCGACCTGACCCCACTGGTGGGCCAG
CTGTCCCTGGGTCAGCTGCAGGAGGTCAGCAAGGCCTTGCAGGACACCCTGGCCTCAGCC
GGTCAGATTCCCTTCCATGCAGAGCCACCGGAAACCATAAGGAGGAAACCATTTCTGGAC
GGC
Restriction Sites Please inquire     
ACCN NM_001164556
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164556.1, NP_001158028.1
RefSeq Size 1553 bp
RefSeq ORF 606 bp
Locus ID 27185
UniProt ID Q9NRI5
Gene Summary This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (t) lacks four internal exons and multiple 3' exons but has an alternate 3' segment, as compared to variant L. The resulting isoform (t, also known as isoform 34) is the shortest, and has a distinct C-terminus, as compared to isoform L.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...