KCNMB3 (NM_001163677) Human Untagged Clone

CAT#: SC326745

KCNMB3 (untagged)-Human potassium large conductance calcium-activated channel subfamily M beta member 3 (KCNMB3) transcript variant 5



  "NM_001163677" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-KCNMB3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326745 representing NM_001163677.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCCCTTCAGCATCCCCGTGCAAATCACACTTCAGGGCAGCCGGAGGCGCCAGGGGAGGACAGCC
TTTCCTGCCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGG
CTGCCATCCAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTA
ATGTTCTTCTTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACC
TGCACTGCCATCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGC
CACGGTCAGGGGAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTC
CTACATTATAATGAAGAGGCTGTCCAGATAAATCCCAAGCGTGATGTTACAGACTGCAGAGTTAAAGAA
AAGCAGACATTGACAGTTTCTGATGAGCATAAACAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001163677
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001163677.1
RefSeq Size 1123 bp
RefSeq ORF 522 bp
Locus ID 27094
UniProt ID Q9NPA1
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Protein Pathways Vascular smooth muscle contraction
MW 19.5 kDa
Gene Summary MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which may partially inactivate or slightly decrease the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 22. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (5) differs in both UTRs and in both the 5' and 3' coding regions, and uses an alternate translational start codon, compared to variant 4. The resulting isoform (e) has distinct N- and C-termini and is shorter than isoform d.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...