RDM1 (NM_001163124) Human Untagged Clone
CAT#: SC326716
RDM1 (untagged)-Human RAD52 motif 1 (RDM1) transcript variant 6
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RAD52B |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001163124, the custom clone sequence may differ by one or more nucleotides
ATGCATTTACTTGTCCCACCCCCACAGCATTCTCTGTTCACAGCATTTTCTCAGTTTGGC CTTCTGTATTCAGTCCGGGTCTTCCCAAATGCTGCAGTGGCCCATCCTGGTTTCTATGCC GTCATTAAGTTTTATTCTGCAAGGGCTGCCCACAGAGCCCAAAAGGCATGCGACCGGAAG CAGCTTTTTCAGAAATCTCCAGTCAAGGTTCGTCTTGGCACCAGACATAAGGCAGTTCAA CATCAAGCCCTTGCCCTGAACAGTTCCAAATGCCAAGAACTGGCGAATTACTACTTTGGT TTCAATGGGTGTTCCAAAAGGATCATCAAGGTCCCTTGCTCTCCCTGGAAGCAGTATGGC CAAGAGGAGGAAGGGTATCTCTCGGATTTCAGCTTGGAGGAGGAAGAGTTCAGGCTGCCA GAACTTGAC |
Restriction Sites | Please inquire |
ACCN | NM_001163124 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163124.1, NP_001156596.1 |
RefSeq Size | 711 bp |
RefSeq ORF | 432 bp |
Locus ID | 201299 |
UniProt ID | Q8NG50 |
Gene Summary | This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) differs in the 5' UTR and coding sequence and lacks an alternate in-frame segment compared to variant 1. The resulting isoform (6, also known as DeltaN-zeta) has a shorter and distinct N-terminus and lacks an internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228081 | RDM1 (Myc-DDK-tagged)-Human RAD52 motif 1 (RDM1), transcript variant 6 |
CNY 3,990.00 |
|
RC228081L3 | Lenti-ORF clone of RDM1 (Myc-DDK-tagged)-Human RAD52 motif 1 (RDM1), transcript variant 6 |
CNY 5,890.00 |
|
RC228081L4 | Lenti-ORF clone of RDM1 (mGFP-tagged)-Human RAD52 motif 1 (RDM1), transcript variant 6 |
CNY 5,890.00 |
|
RG228081 | RDM1 (tGFP-tagged) - Human RAD52 motif 1 (RDM1), transcript variant 6 |
CNY 4,370.00 |